FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630404_at:

>probe:Drosophila_2:1630404_at:330:57; Interrogation_Position=13; Antisense; ATGAGCAAAGCCAAGTCAACCGCCC
>probe:Drosophila_2:1630404_at:543:449; Interrogation_Position=131; Antisense; GATCCGGACGCTTTCGTTCGAAGAA
>probe:Drosophila_2:1630404_at:523:555; Interrogation_Position=136; Antisense; GGACGCTTTCGTTCGAAGAACAAGA
>probe:Drosophila_2:1630404_at:412:51; Interrogation_Position=167; Antisense; ATGCGGTCGACGGAAAGTTCTTTGA
>probe:Drosophila_2:1630404_at:233:289; Interrogation_Position=177; Antisense; CGGAAAGTTCTTTGACGGAGGATCT
>probe:Drosophila_2:1630404_at:432:463; Interrogation_Position=183; Antisense; GTTCTTTGACGGAGGATCTGGATCA
>probe:Drosophila_2:1630404_at:250:41; Interrogation_Position=198; Antisense; ATCTGGATCAGGATCTCTGCAGGAC
>probe:Drosophila_2:1630404_at:471:35; Interrogation_Position=204; Antisense; ATCAGGATCTCTGCAGGACTTCGAG
>probe:Drosophila_2:1630404_at:445:557; Interrogation_Position=219; Antisense; GGACTTCGAGAAGAGCCCATATCTA
>probe:Drosophila_2:1630404_at:40:417; Interrogation_Position=231; Antisense; GAGCCCATATCTAACAATCACTTAG
>probe:Drosophila_2:1630404_at:113:135; Interrogation_Position=38; Antisense; ACGAGCCGACGATCCACTACCTGGA
>probe:Drosophila_2:1630404_at:237:449; Interrogation_Position=48; Antisense; GATCCACTACCTGGACAGCGTGCTG
>probe:Drosophila_2:1630404_at:438:205; Interrogation_Position=85; Antisense; AAGCGGTGCGCCTATGGCCACCAGT
>probe:Drosophila_2:1630404_at:458:681; Interrogation_Position=97; Antisense; TATGGCCACCAGTGGCGCAACTTCT

Paste this into a BLAST search page for me
ATGAGCAAAGCCAAGTCAACCGCCCGATCCGGACGCTTTCGTTCGAAGAAGGACGCTTTCGTTCGAAGAACAAGAATGCGGTCGACGGAAAGTTCTTTGACGGAAAGTTCTTTGACGGAGGATCTGTTCTTTGACGGAGGATCTGGATCAATCTGGATCAGGATCTCTGCAGGACATCAGGATCTCTGCAGGACTTCGAGGGACTTCGAGAAGAGCCCATATCTAGAGCCCATATCTAACAATCACTTAGACGAGCCGACGATCCACTACCTGGAGATCCACTACCTGGACAGCGTGCTGAAGCGGTGCGCCTATGGCCACCAGTTATGGCCACCAGTGGCGCAACTTCT

Full Affymetrix probeset data:

Annotations for 1630404_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720