Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630405_at:

>probe:Drosophila_2:1630405_at:37:433; Interrogation_Position=557; Antisense; GAGTGCGAGTTTTACCTGCTGGAGA
>probe:Drosophila_2:1630405_at:711:551; Interrogation_Position=577; Antisense; GGAGAACCTGGATTGCTGCTTGATT
>probe:Drosophila_2:1630405_at:197:619; Interrogation_Position=593; Antisense; TGCTTGATTGTCTACCAGCCGTACA
>probe:Drosophila_2:1630405_at:633:333; Interrogation_Position=622; Antisense; GCTGCTGCAGCTGGTTCAGGACATG
>probe:Drosophila_2:1630405_at:432:63; Interrogation_Position=644; Antisense; ATGGGCCAGGAGGACCAGTTGCTCA
>probe:Drosophila_2:1630405_at:117:649; Interrogation_Position=666; Antisense; TCACCCTGAGCTGGCGTATCGTAAA
>probe:Drosophila_2:1630405_at:330:473; Interrogation_Position=681; Antisense; GTATCGTAAACGATTCCCTGCGCAC
>probe:Drosophila_2:1630405_at:186:683; Interrogation_Position=722; Antisense; TATCCTCCTTACCAGATCGCTATAG
>probe:Drosophila_2:1630405_at:573:39; Interrogation_Position=737; Antisense; ATCGCTATAGCCTGCCTTCAAATCG
>probe:Drosophila_2:1630405_at:689:221; Interrogation_Position=827; Antisense; AAGGTCCAGGAGATCGTGCGCGCCA
>probe:Drosophila_2:1630405_at:710:291; Interrogation_Position=841; Antisense; CGTGCGCGCCATTGTAAATCTGTAC
>probe:Drosophila_2:1630405_at:41:447; Interrogation_Position=904; Antisense; GATGCTGCTGTCCAAGATTCCGAAA
>probe:Drosophila_2:1630405_at:375:261; Interrogation_Position=936; Antisense; CACCGCCTCAGCGTTAGAAGAGCTT
>probe:Drosophila_2:1630405_at:26:323; Interrogation_Position=988; Antisense; GCCCAATTGTGTGTTTGTACTCATA

Paste this into a BLAST search page for me
GAGTGCGAGTTTTACCTGCTGGAGAGGAGAACCTGGATTGCTGCTTGATTTGCTTGATTGTCTACCAGCCGTACAGCTGCTGCAGCTGGTTCAGGACATGATGGGCCAGGAGGACCAGTTGCTCATCACCCTGAGCTGGCGTATCGTAAAGTATCGTAAACGATTCCCTGCGCACTATCCTCCTTACCAGATCGCTATAGATCGCTATAGCCTGCCTTCAAATCGAAGGTCCAGGAGATCGTGCGCGCCACGTGCGCGCCATTGTAAATCTGTACGATGCTGCTGTCCAAGATTCCGAAACACCGCCTCAGCGTTAGAAGAGCTTGCCCAATTGTGTGTTTGTACTCATA

Full Affymetrix probeset data:

Annotations for 1630405_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime