FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630406_at:

>probe:Drosophila_2:1630406_at:308:457; Interrogation_Position=153; Antisense; GATAGAGCAGCTGGTCTACGGCCAC
>probe:Drosophila_2:1630406_at:234:391; Interrogation_Position=187; Antisense; GAAACGGAACTGCATCCAACCATTG
>probe:Drosophila_2:1630406_at:185:345; Interrogation_Position=269; Antisense; GCATCTACGACACGGCCGGATTGCA
>probe:Drosophila_2:1630406_at:622:147; Interrogation_Position=320; Antisense; ACTACCTTCAGTTTCCAGATGCATT
>probe:Drosophila_2:1630406_at:146:445; Interrogation_Position=337; Antisense; GATGCATTCGTTCTGGTCTACGATC
>probe:Drosophila_2:1630406_at:168:53; Interrogation_Position=385; Antisense; ATGCTGGCCGACATCAAGGCTGACA
>probe:Drosophila_2:1630406_at:22:95; Interrogation_Position=434; Antisense; AGATTCCCGTTGTGGTGCTGGCCAA
>probe:Drosophila_2:1630406_at:374:197; Interrogation_Position=457; Antisense; AACGTGAGGGCACGAGCAGCCCCAA
>probe:Drosophila_2:1630406_at:215:423; Interrogation_Position=490; Antisense; GAGAAGGTCATGGACCGCGCCAACA
>probe:Drosophila_2:1630406_at:636:271; Interrogation_Position=513; Antisense; CATCTGGTGCCAGCGAGAGCGCATA
>probe:Drosophila_2:1630406_at:16:103; Interrogation_Position=528; Antisense; AGAGCGCATAAAGCACTACACGGTG
>probe:Drosophila_2:1630406_at:319:51; Interrogation_Position=616; Antisense; ATGCAGACGAAGAGCACGTTCCCTC
>probe:Drosophila_2:1630406_at:242:307; Interrogation_Position=637; Antisense; CCTCAGCTGCGCCAAGTTATGCAGA
>probe:Drosophila_2:1630406_at:615:107; Interrogation_Position=659; Antisense; AGAACCGGCAGAAGAGCGAGGCTTA

Paste this into a BLAST search page for me
GATAGAGCAGCTGGTCTACGGCCACGAAACGGAACTGCATCCAACCATTGGCATCTACGACACGGCCGGATTGCAACTACCTTCAGTTTCCAGATGCATTGATGCATTCGTTCTGGTCTACGATCATGCTGGCCGACATCAAGGCTGACAAGATTCCCGTTGTGGTGCTGGCCAAAACGTGAGGGCACGAGCAGCCCCAAGAGAAGGTCATGGACCGCGCCAACACATCTGGTGCCAGCGAGAGCGCATAAGAGCGCATAAAGCACTACACGGTGATGCAGACGAAGAGCACGTTCCCTCCCTCAGCTGCGCCAAGTTATGCAGAAGAACCGGCAGAAGAGCGAGGCTTA

Full Affymetrix probeset data:

Annotations for 1630406_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720