FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630407_at:

>probe:Drosophila_2:1630407_at:636:651; Interrogation_Position=272; Antisense; TCAAAAGACGGTTCGCCGGCGGATT
>probe:Drosophila_2:1630407_at:286:491; Interrogation_Position=304; Antisense; GTAAAGTCCAGATCGCCAACCATTG
>probe:Drosophila_2:1630407_at:320:711; Interrogation_Position=358; Antisense; TTCAGCATCGTGGATTGCAGCCTGG
>probe:Drosophila_2:1630407_at:590:261; Interrogation_Position=375; Antisense; CAGCCTGGTGCATCTGCGCAAGAAG
>probe:Drosophila_2:1630407_at:331:313; Interrogation_Position=472; Antisense; GCCATGTTCGGAAGCGCCATCATTG
>probe:Drosophila_2:1630407_at:503:37; Interrogation_Position=490; Antisense; ATCATTGGCGGAGTTCTGCTCTCAA
>probe:Drosophila_2:1630407_at:236:115; Interrogation_Position=557; Antisense; AGCAGTTTCGCAATTCTGATCCGCA
>probe:Drosophila_2:1630407_at:547:293; Interrogation_Position=585; Antisense; CGATCTAGGCAGAGCAGGCGCGTTT
>probe:Drosophila_2:1630407_at:244:321; Interrogation_Position=602; Antisense; GCGCGTTTGCTTCTGGATCCGGAAT
>probe:Drosophila_2:1630407_at:23:459; Interrogation_Position=637; Antisense; GATATTAATTCATCACCGGGCTTTG
>probe:Drosophila_2:1630407_at:701:713; Interrogation_Position=659; Antisense; TTGAGTTCCCCGTAGTGCAGCAGGC
>probe:Drosophila_2:1630407_at:82:339; Interrogation_Position=695; Antisense; GCTAAATTTCTGTTCTCATTCTGCC
>probe:Drosophila_2:1630407_at:478:641; Interrogation_Position=754; Antisense; TCTTTCGTTGTTTACTTTCGCTCCA
>probe:Drosophila_2:1630407_at:351:695; Interrogation_Position=769; Antisense; TTTCGCTCCATGATTTTGTGTGCCT

Paste this into a BLAST search page for me
TCAAAAGACGGTTCGCCGGCGGATTGTAAAGTCCAGATCGCCAACCATTGTTCAGCATCGTGGATTGCAGCCTGGCAGCCTGGTGCATCTGCGCAAGAAGGCCATGTTCGGAAGCGCCATCATTGATCATTGGCGGAGTTCTGCTCTCAAAGCAGTTTCGCAATTCTGATCCGCACGATCTAGGCAGAGCAGGCGCGTTTGCGCGTTTGCTTCTGGATCCGGAATGATATTAATTCATCACCGGGCTTTGTTGAGTTCCCCGTAGTGCAGCAGGCGCTAAATTTCTGTTCTCATTCTGCCTCTTTCGTTGTTTACTTTCGCTCCATTTCGCTCCATGATTTTGTGTGCCT

Full Affymetrix probeset data:

Annotations for 1630407_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720