FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630409_at:

>probe:Drosophila_2:1630409_at:403:113; Interrogation_Position=1540; Antisense; AGCAGAATATCGATCGGCGTCAGAT
>probe:Drosophila_2:1630409_at:248:537; Interrogation_Position=1586; Antisense; GGTAAAGTCTGATTCCATCGAGTTA
>probe:Drosophila_2:1630409_at:60:67; Interrogation_Position=1629; Antisense; ATGGACTCTCAGTTGCGGGCGCAGA
>probe:Drosophila_2:1630409_at:305:523; Interrogation_Position=1645; Antisense; GGGCGCAGAAACAGCGTCTGACCAA
>probe:Drosophila_2:1630409_at:425:167; Interrogation_Position=1669; Antisense; AAATGGAGGCCAGTTATCGGACCAA
>probe:Drosophila_2:1630409_at:83:703; Interrogation_Position=1682; Antisense; TTATCGGACCAAGCGCGACATGCAG
>probe:Drosophila_2:1630409_at:24:357; Interrogation_Position=1712; Antisense; GCACAGGCAACAGCTGCTCGAGGAT
>probe:Drosophila_2:1630409_at:37:101; Interrogation_Position=1747; Antisense; AGACCGCCCGTCTGGATGAGTTGGA
>probe:Drosophila_2:1630409_at:494:561; Interrogation_Position=1819; Antisense; GGAACGAGGATCTACTCACCGCTGC
>probe:Drosophila_2:1630409_at:339:119; Interrogation_Position=1927; Antisense; AGCTGCTCGCCGTGGAATCAAAGGT
>probe:Drosophila_2:1630409_at:698:167; Interrogation_Position=1946; Antisense; AAAGGTCAACGCGACTCAGGCCAAG
>probe:Drosophila_2:1630409_at:51:359; Interrogation_Position=1985; Antisense; GCAAAAGGTGTACTCCGCCAAGCTG
>probe:Drosophila_2:1630409_at:618:649; Interrogation_Position=2018; Antisense; TCAGCCCGTGCTAGATGCCATCAAG
>probe:Drosophila_2:1630409_at:684:447; Interrogation_Position=2055; Antisense; GATCCGGATGTTTTGTTGTAGTCCA

Paste this into a BLAST search page for me
AGCAGAATATCGATCGGCGTCAGATGGTAAAGTCTGATTCCATCGAGTTAATGGACTCTCAGTTGCGGGCGCAGAGGGCGCAGAAACAGCGTCTGACCAAAAATGGAGGCCAGTTATCGGACCAATTATCGGACCAAGCGCGACATGCAGGCACAGGCAACAGCTGCTCGAGGATAGACCGCCCGTCTGGATGAGTTGGAGGAACGAGGATCTACTCACCGCTGCAGCTGCTCGCCGTGGAATCAAAGGTAAAGGTCAACGCGACTCAGGCCAAGGCAAAAGGTGTACTCCGCCAAGCTGTCAGCCCGTGCTAGATGCCATCAAGGATCCGGATGTTTTGTTGTAGTCCA

Full Affymetrix probeset data:

Annotations for 1630409_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720