FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630410_at:

>probe:Drosophila_2:1630410_at:238:567; Interrogation_Position=221; Antisense; GGCATAAGAGAGGTCGGTTCTACAC
>probe:Drosophila_2:1630410_at:490:541; Interrogation_Position=236; Antisense; GGTTCTACACCGACATTGGCGAGCT
>probe:Drosophila_2:1630410_at:190:415; Interrogation_Position=256; Antisense; GAGCTCCGGGCTGTATTGGTATACT
>probe:Drosophila_2:1630410_at:614:3; Interrogation_Position=270; Antisense; ATTGGTATACTCCATCAGGGACGGT
>probe:Drosophila_2:1630410_at:119:267; Interrogation_Position=285; Antisense; CAGGGACGGTGTGATGACCATCAAC
>probe:Drosophila_2:1630410_at:236:651; Interrogation_Position=305; Antisense; TCAACAGCACCAACGTCCCGGAGGA
>probe:Drosophila_2:1630410_at:460:331; Interrogation_Position=335; Antisense; GCGGACATGGCATTGGGAAGCTACT
>probe:Drosophila_2:1630410_at:20:579; Interrogation_Position=360; Antisense; GGCCAAGTCGGCACTGGACTACGCA
>probe:Drosophila_2:1630410_at:12:405; Interrogation_Position=376; Antisense; GACTACGCACTGTTGAATGGGCACT
>probe:Drosophila_2:1630410_at:355:31; Interrogation_Position=409; Antisense; ATAAGGTGTCGGTTTGTCCAGCACT
>probe:Drosophila_2:1630410_at:34:541; Interrogation_Position=419; Antisense; GGTTTGTCCAGCACTACATCGACAA
>probe:Drosophila_2:1630410_at:265:57; Interrogation_Position=446; Antisense; ATGAGCCGCAATACGCCAAGTACAT
>probe:Drosophila_2:1630410_at:544:291; Interrogation_Position=573; Antisense; CGTATATTTGCGTTCAGATTTGTTG
>probe:Drosophila_2:1630410_at:212:265; Interrogation_Position=587; Antisense; CAGATTTGTTGAATTCCTTCGGTTT

Paste this into a BLAST search page for me
GGCATAAGAGAGGTCGGTTCTACACGGTTCTACACCGACATTGGCGAGCTGAGCTCCGGGCTGTATTGGTATACTATTGGTATACTCCATCAGGGACGGTCAGGGACGGTGTGATGACCATCAACTCAACAGCACCAACGTCCCGGAGGAGCGGACATGGCATTGGGAAGCTACTGGCCAAGTCGGCACTGGACTACGCAGACTACGCACTGTTGAATGGGCACTATAAGGTGTCGGTTTGTCCAGCACTGGTTTGTCCAGCACTACATCGACAAATGAGCCGCAATACGCCAAGTACATCGTATATTTGCGTTCAGATTTGTTGCAGATTTGTTGAATTCCTTCGGTTT

Full Affymetrix probeset data:

Annotations for 1630410_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720