FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630411_at:

>probe:Drosophila_2:1630411_at:153:541; Interrogation_Position=1748; Antisense; GGACTAGTTGTAAGGTTTAGAGTAT
>probe:Drosophila_2:1630411_at:552:407; Interrogation_Position=1767; Antisense; GAGTATAAGCTAGTAAGGTCCCCTT
>probe:Drosophila_2:1630411_at:488:483; Interrogation_Position=1769; Antisense; GTATAAGCTAGTAAGGTCCCCTTTG
>probe:Drosophila_2:1630411_at:420:207; Interrogation_Position=1773; Antisense; AAGCTAGTAAGGTCCCCTTTGATAT
>probe:Drosophila_2:1630411_at:320:493; Interrogation_Position=1779; Antisense; GTAAGGTCCCCTTTGATATTACATT
>probe:Drosophila_2:1630411_at:659:77; Interrogation_Position=1782; Antisense; AGGTCCCCTTTGATATTACATTTCG
>probe:Drosophila_2:1630411_at:592:501; Interrogation_Position=1784; Antisense; GTCCCCTTTGATATTACATTTCGTT
>probe:Drosophila_2:1630411_at:22:667; Interrogation_Position=1798; Antisense; TACATTTCGTTACATTCATTCATAG
>probe:Drosophila_2:1630411_at:455:715; Interrogation_Position=1803; Antisense; TTCGTTACATTCATTCATAGTGGCT
>probe:Drosophila_2:1630411_at:39:667; Interrogation_Position=1808; Antisense; TACATTCATTCATAGTGGCTTGCCT
>probe:Drosophila_2:1630411_at:295:13; Interrogation_Position=1811; Antisense; ATTCATTCATAGTGGCTTGCCTAAG
>probe:Drosophila_2:1630411_at:277:635; Interrogation_Position=2060; Antisense; TCGTTTGCTCGATCTAAATTCCTTG
>probe:Drosophila_2:1630411_at:524:479; Interrogation_Position=2062; Antisense; GTTTGCTCGATCTAAATTCCTTGAA
>probe:Drosophila_2:1630411_at:263:693; Interrogation_Position=2063; Antisense; TTTGCTCGATCTAAATTCCTTGAAA

Paste this into a BLAST search page for me
GGACTAGTTGTAAGGTTTAGAGTATGAGTATAAGCTAGTAAGGTCCCCTTGTATAAGCTAGTAAGGTCCCCTTTGAAGCTAGTAAGGTCCCCTTTGATATGTAAGGTCCCCTTTGATATTACATTAGGTCCCCTTTGATATTACATTTCGGTCCCCTTTGATATTACATTTCGTTTACATTTCGTTACATTCATTCATAGTTCGTTACATTCATTCATAGTGGCTTACATTCATTCATAGTGGCTTGCCTATTCATTCATAGTGGCTTGCCTAAGTCGTTTGCTCGATCTAAATTCCTTGGTTTGCTCGATCTAAATTCCTTGAATTTGCTCGATCTAAATTCCTTGAAA

Full Affymetrix probeset data:

Annotations for 1630411_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720