FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630414_at:

>probe:Drosophila_2:1630414_at:713:523; Interrogation_Position=459; Antisense; GGGCTTTATTGTCTGGTGCGATTCC
>probe:Drosophila_2:1630414_at:540:507; Interrogation_Position=474; Antisense; GTGCGATTCCATGACCGAGAGATTC
>probe:Drosophila_2:1630414_at:716:425; Interrogation_Position=490; Antisense; GAGAGATTCCCATCCTGTGCCATTT
>probe:Drosophila_2:1630414_at:174:273; Interrogation_Position=510; Antisense; CATTTCCGCCGGTCAGAACATTATC
>probe:Drosophila_2:1630414_at:602:385; Interrogation_Position=525; Antisense; GAACATTATCCACGGCGACACGGAA
>probe:Drosophila_2:1630414_at:347:661; Interrogation_Position=555; Antisense; TAACACCTCCGGATTTTACATTGAA
>probe:Drosophila_2:1630414_at:231:63; Interrogation_Position=580; Antisense; ATGGGAACCACTCAGTTTGGCGCAT
>probe:Drosophila_2:1630414_at:6:541; Interrogation_Position=607; Antisense; GGTTCATTCGCAATTTCCGTTGGCA
>probe:Drosophila_2:1630414_at:257:647; Interrogation_Position=638; Antisense; TCATCGCCCTTCTGAAACTGATCGA
>probe:Drosophila_2:1630414_at:682:305; Interrogation_Position=692; Antisense; CCATGTACTTGGAGCGACAGCGGTT
>probe:Drosophila_2:1630414_at:118:247; Interrogation_Position=831; Antisense; AATTCTCTACGTATTTCTCATCATG
>probe:Drosophila_2:1630414_at:688:3; Interrogation_Position=868; Antisense; ATTGTATGTCATTTCGTCCTCGTCC
>probe:Drosophila_2:1630414_at:637:501; Interrogation_Position=883; Antisense; GTCCTCGTCCTTATCATTGAGGCAG
>probe:Drosophila_2:1630414_at:19:161; Interrogation_Position=908; Antisense; ACAACCGGCAACACACATTATCTTT

Paste this into a BLAST search page for me
GGGCTTTATTGTCTGGTGCGATTCCGTGCGATTCCATGACCGAGAGATTCGAGAGATTCCCATCCTGTGCCATTTCATTTCCGCCGGTCAGAACATTATCGAACATTATCCACGGCGACACGGAATAACACCTCCGGATTTTACATTGAAATGGGAACCACTCAGTTTGGCGCATGGTTCATTCGCAATTTCCGTTGGCATCATCGCCCTTCTGAAACTGATCGACCATGTACTTGGAGCGACAGCGGTTAATTCTCTACGTATTTCTCATCATGATTGTATGTCATTTCGTCCTCGTCCGTCCTCGTCCTTATCATTGAGGCAGACAACCGGCAACACACATTATCTTT

Full Affymetrix probeset data:

Annotations for 1630414_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720