FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630415_at:

>probe:Drosophila_2:1630415_at:225:27; Interrogation_Position=4666; Antisense; ATAGCAACATTACAGGCGGCCCAGT
>probe:Drosophila_2:1630415_at:704:265; Interrogation_Position=4687; Antisense; CAGTCGACGACAGCCGTAGCGGAAA
>probe:Drosophila_2:1630415_at:302:209; Interrogation_Position=4716; Antisense; AAGCACCAGCACTGCCATGTTTCAA
>probe:Drosophila_2:1630415_at:367:59; Interrogation_Position=4732; Antisense; ATGTTTCAAGCCCAGGCCAGTGCGA
>probe:Drosophila_2:1630415_at:333:85; Interrogation_Position=4750; Antisense; AGTGCGAACCAAAAGCCAACCAAGT
>probe:Drosophila_2:1630415_at:425:255; Interrogation_Position=4812; Antisense; CAAACTACTGAAAATGCTGCCGACA
>probe:Drosophila_2:1630415_at:671:267; Interrogation_Position=4853; Antisense; CAGGTGCAGCGACCACTGAATTCAA
>probe:Drosophila_2:1630415_at:7:443; Interrogation_Position=4908; Antisense; GATGTTCAACGATGATTCCAACGCC
>probe:Drosophila_2:1630415_at:522:211; Interrogation_Position=4940; Antisense; AAGACTTTTCAATCGACTCGTTATT
>probe:Drosophila_2:1630415_at:644:135; Interrogation_Position=5027; Antisense; ACATACAAACAGAGCCCGACCGCGT
>probe:Drosophila_2:1630415_at:665:327; Interrogation_Position=5048; Antisense; GCGTTCCTAGTTTCCTCCAACAGAA
>probe:Drosophila_2:1630415_at:363:697; Interrogation_Position=5088; Antisense; TTTAGCCAATCGAGTAGCCACACCA
>probe:Drosophila_2:1630415_at:497:487; Interrogation_Position=5101; Antisense; GTAGCCACACCATGAACATAGCGAC
>probe:Drosophila_2:1630415_at:265:145; Interrogation_Position=5184; Antisense; ACTAATGCCGCAATTCATAGCTAGC

Paste this into a BLAST search page for me
ATAGCAACATTACAGGCGGCCCAGTCAGTCGACGACAGCCGTAGCGGAAAAAGCACCAGCACTGCCATGTTTCAAATGTTTCAAGCCCAGGCCAGTGCGAAGTGCGAACCAAAAGCCAACCAAGTCAAACTACTGAAAATGCTGCCGACACAGGTGCAGCGACCACTGAATTCAAGATGTTCAACGATGATTCCAACGCCAAGACTTTTCAATCGACTCGTTATTACATACAAACAGAGCCCGACCGCGTGCGTTCCTAGTTTCCTCCAACAGAATTTAGCCAATCGAGTAGCCACACCAGTAGCCACACCATGAACATAGCGACACTAATGCCGCAATTCATAGCTAGC

Full Affymetrix probeset data:

Annotations for 1630415_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720