FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630416_at:

>probe:Drosophila_2:1630416_at:500:583; Interrogation_Position=1080; Antisense; TGGAGACGGTAATCCCCGCTTTGGA
>probe:Drosophila_2:1630416_at:606:395; Interrogation_Position=1103; Antisense; GACAAGCCTGTCATGGTGGTTAATG
>probe:Drosophila_2:1630416_at:253:527; Interrogation_Position=1138; Antisense; GGGATCCGAGGCTCTGCTAAGGAAA
>probe:Drosophila_2:1630416_at:200:555; Interrogation_Position=1165; Antisense; GGACGAGCGCAGATATTCAGTCAGC
>probe:Drosophila_2:1630416_at:311:611; Interrogation_Position=1200; Antisense; TGCACGGTCCTCTCAAAGGCAGAAT
>probe:Drosophila_2:1630416_at:602:37; Interrogation_Position=1252; Antisense; ATCTAAACTACATGGCGCCTAGCTG
>probe:Drosophila_2:1630416_at:584:315; Interrogation_Position=1268; Antisense; GCCTAGCTGCGCTTTTCTAAGTTAA
>probe:Drosophila_2:1630416_at:238:463; Interrogation_Position=1301; Antisense; GTTGTACCTTTTTATGCCTAATTTG
>probe:Drosophila_2:1630416_at:201:39; Interrogation_Position=1389; Antisense; ATCTGCACATAATACGTTCGTTACT
>probe:Drosophila_2:1630416_at:497:473; Interrogation_Position=1408; Antisense; GTTACTTAAATTTGGACTGCTCAGC
>probe:Drosophila_2:1630416_at:519:405; Interrogation_Position=1422; Antisense; GACTGCTCAGCATTTGGGTTAATAA
>probe:Drosophila_2:1630416_at:707:75; Interrogation_Position=897; Antisense; AGGAGCGTGCCAACCGCAAGGACTA
>probe:Drosophila_2:1630416_at:413:223; Interrogation_Position=914; Antisense; AAGGACTACTGGCTGCACAAGGGTA
>probe:Drosophila_2:1630416_at:530:17; Interrogation_Position=949; Antisense; ATTTATTTCCAAATCCATGGGCGAA

Paste this into a BLAST search page for me
TGGAGACGGTAATCCCCGCTTTGGAGACAAGCCTGTCATGGTGGTTAATGGGGATCCGAGGCTCTGCTAAGGAAAGGACGAGCGCAGATATTCAGTCAGCTGCACGGTCCTCTCAAAGGCAGAATATCTAAACTACATGGCGCCTAGCTGGCCTAGCTGCGCTTTTCTAAGTTAAGTTGTACCTTTTTATGCCTAATTTGATCTGCACATAATACGTTCGTTACTGTTACTTAAATTTGGACTGCTCAGCGACTGCTCAGCATTTGGGTTAATAAAGGAGCGTGCCAACCGCAAGGACTAAAGGACTACTGGCTGCACAAGGGTAATTTATTTCCAAATCCATGGGCGAA

Full Affymetrix probeset data:

Annotations for 1630416_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720