Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630417_at:

>probe:Drosophila_2:1630417_at:299:129; Interrogation_Position=6598; Antisense; ACCTGTCCGGTTCCAGCTCTAGTTT
>probe:Drosophila_2:1630417_at:173:645; Interrogation_Position=6615; Antisense; TCTAGTTTCTCCGATCGCAAGGCGA
>probe:Drosophila_2:1630417_at:234:539; Interrogation_Position=6649; Antisense; GGTATACCTACAAGGGTGGCCCTGT
>probe:Drosophila_2:1630417_at:621:521; Interrogation_Position=6664; Antisense; GTGGCCCTGTTCATGAATGGACCAA
>probe:Drosophila_2:1630417_at:466:399; Interrogation_Position=6700; Antisense; GACACTGGCTGATGGGCATCGAGCT
>probe:Drosophila_2:1630417_at:40:347; Interrogation_Position=6715; Antisense; GCATCGAGCTGGAGCGTTACATCCC
>probe:Drosophila_2:1630417_at:279:475; Interrogation_Position=6730; Antisense; GTTACATCCCCGTCTTCAAGGAGAA
>probe:Drosophila_2:1630417_at:60:139; Interrogation_Position=6757; Antisense; ACGTGGAGGGCGGAGCTCTTCTTAC
>probe:Drosophila_2:1630417_at:209:339; Interrogation_Position=6771; Antisense; GCTCTTCTTACCCTGGACTCAAAGG
>probe:Drosophila_2:1630417_at:238:175; Interrogation_Position=6802; Antisense; AAACCTTGGGTATCTGTGGCGACGA
>probe:Drosophila_2:1630417_at:483:207; Interrogation_Position=6828; Antisense; AAGCATCGTCTGAAGAAGCGTCTTA
>probe:Drosophila_2:1630417_at:694:205; Interrogation_Position=6843; Antisense; AAGCGTCTTAAGGACCTGAAGGCCA
>probe:Drosophila_2:1630417_at:465:555; Interrogation_Position=6854; Antisense; GGACCTGAAGGCCAACATCGAGAAG
>probe:Drosophila_2:1630417_at:122:159; Interrogation_Position=7054; Antisense; ACACACAAGGAAAACACGCGCGTAT

Paste this into a BLAST search page for me
ACCTGTCCGGTTCCAGCTCTAGTTTTCTAGTTTCTCCGATCGCAAGGCGAGGTATACCTACAAGGGTGGCCCTGTGTGGCCCTGTTCATGAATGGACCAAGACACTGGCTGATGGGCATCGAGCTGCATCGAGCTGGAGCGTTACATCCCGTTACATCCCCGTCTTCAAGGAGAAACGTGGAGGGCGGAGCTCTTCTTACGCTCTTCTTACCCTGGACTCAAAGGAAACCTTGGGTATCTGTGGCGACGAAAGCATCGTCTGAAGAAGCGTCTTAAAGCGTCTTAAGGACCTGAAGGCCAGGACCTGAAGGCCAACATCGAGAAGACACACAAGGAAAACACGCGCGTAT

Full Affymetrix probeset data:

Annotations for 1630417_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime