FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630421_at:

>probe:Drosophila_2:1630421_at:543:641; Interrogation_Position=128; Antisense; TCTGCGAAAACTTGCCCACCGGAAG
>probe:Drosophila_2:1630421_at:137:563; Interrogation_Position=148; Antisense; GGAAGTTCGCCAGCCATTGCCGTGC
>probe:Drosophila_2:1630421_at:271:3; Interrogation_Position=163; Antisense; ATTGCCGTGCTGTCCCAAAAAACGC
>probe:Drosophila_2:1630421_at:165:711; Interrogation_Position=215; Antisense; TTCTCGACGTTAACTTTTGGCGCCG
>probe:Drosophila_2:1630421_at:303:481; Interrogation_Position=244; Antisense; GTATACGGGAATCTATGTCTCACAG
>probe:Drosophila_2:1630421_at:652:449; Interrogation_Position=293; Antisense; GATCCCCAGAAGTTGATGCAGCGTT
>probe:Drosophila_2:1630421_at:103:483; Interrogation_Position=361; Antisense; GTAACAGCCTTGGTAGTTTCGTACA
>probe:Drosophila_2:1630421_at:533:453; Interrogation_Position=388; Antisense; GATAACGTTACCTTCACTAAATTCA
>probe:Drosophila_2:1630421_at:447:385; Interrogation_Position=464; Antisense; GAACTTGTCAACTAAACCTGGATTT
>probe:Drosophila_2:1630421_at:585:35; Interrogation_Position=498; Antisense; ATCTTATATTAAGCTTTCCACGCGC
>probe:Drosophila_2:1630421_at:437:275; Interrogation_Position=511; Antisense; CTTTCCACGCGCTTGTTTTACAAAT
>probe:Drosophila_2:1630421_at:500:605; Interrogation_Position=579; Antisense; TGATGATATCTTTCTACTGTGGTGA
>probe:Drosophila_2:1630421_at:248:519; Interrogation_Position=597; Antisense; GTGGTGAATGATGGCTTTTCCGAAT
>probe:Drosophila_2:1630421_at:95:723; Interrogation_Position=631; Antisense; TTGCCAGGTGCAACCATGACGAAAT

Paste this into a BLAST search page for me
TCTGCGAAAACTTGCCCACCGGAAGGGAAGTTCGCCAGCCATTGCCGTGCATTGCCGTGCTGTCCCAAAAAACGCTTCTCGACGTTAACTTTTGGCGCCGGTATACGGGAATCTATGTCTCACAGGATCCCCAGAAGTTGATGCAGCGTTGTAACAGCCTTGGTAGTTTCGTACAGATAACGTTACCTTCACTAAATTCAGAACTTGTCAACTAAACCTGGATTTATCTTATATTAAGCTTTCCACGCGCCTTTCCACGCGCTTGTTTTACAAATTGATGATATCTTTCTACTGTGGTGAGTGGTGAATGATGGCTTTTCCGAATTTGCCAGGTGCAACCATGACGAAAT

Full Affymetrix probeset data:

Annotations for 1630421_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720