FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630422_at:

>probe:Drosophila_2:1630422_at:603:175; Interrogation_Position=1058; Antisense; AAACGGTCCTCGAACGCACAAACAT
>probe:Drosophila_2:1630422_at:234:161; Interrogation_Position=1168; Antisense; ACAATGTGGAACTCGGTGGTGCTAT
>probe:Drosophila_2:1630422_at:47:631; Interrogation_Position=1180; Antisense; TCGGTGGTGCTATGGTTTTTCCAAA
>probe:Drosophila_2:1630422_at:476:683; Interrogation_Position=1213; Antisense; TATCCGTCTTTCCTCAAAAGGGCAG
>probe:Drosophila_2:1630422_at:620:81; Interrogation_Position=1231; Antisense; AGGGCAGCTGTCTCTTTTGGCATAA
>probe:Drosophila_2:1630422_at:169:607; Interrogation_Position=1262; Antisense; TGATCCTCGCAGTGAGCCTTTGGAA
>probe:Drosophila_2:1630422_at:330:583; Interrogation_Position=1282; Antisense; TGGAATGCCCAGTTCTTCAAGGAAA
>probe:Drosophila_2:1630422_at:527:395; Interrogation_Position=746; Antisense; GACAAAACCCTCAGACTACGAAATT
>probe:Drosophila_2:1630422_at:148:163; Interrogation_Position=766; Antisense; AAATTGGATGTCGTGGCCAGTTTCT
>probe:Drosophila_2:1630422_at:525:479; Interrogation_Position=807; Antisense; GTTTGCACCTATAATTTCACCATAA
>probe:Drosophila_2:1630422_at:384:363; Interrogation_Position=834; Antisense; GAATTCTTGAAACTAGCTCCCTTGA
>probe:Drosophila_2:1630422_at:158:35; Interrogation_Position=898; Antisense; ATCACGATGTTCTTAATGACGACGA
>probe:Drosophila_2:1630422_at:19:201; Interrogation_Position=939; Antisense; AACCACTTGAATGATACTGACGCGG
>probe:Drosophila_2:1630422_at:476:175; Interrogation_Position=984; Antisense; AAACGCATCTTTCAACGCATAAACG

Paste this into a BLAST search page for me
AAACGGTCCTCGAACGCACAAACATACAATGTGGAACTCGGTGGTGCTATTCGGTGGTGCTATGGTTTTTCCAAATATCCGTCTTTCCTCAAAAGGGCAGAGGGCAGCTGTCTCTTTTGGCATAATGATCCTCGCAGTGAGCCTTTGGAATGGAATGCCCAGTTCTTCAAGGAAAGACAAAACCCTCAGACTACGAAATTAAATTGGATGTCGTGGCCAGTTTCTGTTTGCACCTATAATTTCACCATAAGAATTCTTGAAACTAGCTCCCTTGAATCACGATGTTCTTAATGACGACGAAACCACTTGAATGATACTGACGCGGAAACGCATCTTTCAACGCATAAACG

Full Affymetrix probeset data:

Annotations for 1630422_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720