Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630423_at:

>probe:Drosophila_2:1630423_at:448:351; Interrogation_Position=2945; Antisense; GCAGAAGAACAACCACGGATCCGTA
>probe:Drosophila_2:1630423_at:526:43; Interrogation_Position=2963; Antisense; ATCCGTAGCCGGCTCAAATTTAAGC
>probe:Drosophila_2:1630423_at:663:709; Interrogation_Position=2982; Antisense; TTAAGCAGCGTTATCTGAGCTCCCC
>probe:Drosophila_2:1630423_at:44:239; Interrogation_Position=3068; Antisense; AATCTCATGACATTCTTTACGTGTA
>probe:Drosophila_2:1630423_at:423:663; Interrogation_Position=3085; Antisense; TACGTGTAATTAACATTCCGTTTAG
>probe:Drosophila_2:1630423_at:158:597; Interrogation_Position=3123; Antisense; TGTGTTTAAGGCTAATGATTCTACC
>probe:Drosophila_2:1630423_at:281:461; Interrogation_Position=3139; Antisense; GATTCTACCTTAGTTATACAGGCGA
>probe:Drosophila_2:1630423_at:184:153; Interrogation_Position=3156; Antisense; ACAGGCGATCTCCATGAAGTACTTC
>probe:Drosophila_2:1630423_at:486:175; Interrogation_Position=3202; Antisense; AAACCCTCCTTAAGTGCAATCTATC
>probe:Drosophila_2:1630423_at:301:511; Interrogation_Position=3215; Antisense; GTGCAATCTATCCTATAATCTTTCT
>probe:Drosophila_2:1630423_at:417:565; Interrogation_Position=3251; Antisense; GGCAATTGGTTTACCATTCACCATG
>probe:Drosophila_2:1630423_at:257:711; Interrogation_Position=3267; Antisense; TTCACCATGACTTAAGTACCTAGAG
>probe:Drosophila_2:1630423_at:567:483; Interrogation_Position=3422; Antisense; GTATCGATTTGATTTGCGCGCCTCC
>probe:Drosophila_2:1630423_at:660:307; Interrogation_Position=3446; Antisense; CCACGATCACACACCATTAACTATT

Paste this into a BLAST search page for me
GCAGAAGAACAACCACGGATCCGTAATCCGTAGCCGGCTCAAATTTAAGCTTAAGCAGCGTTATCTGAGCTCCCCAATCTCATGACATTCTTTACGTGTATACGTGTAATTAACATTCCGTTTAGTGTGTTTAAGGCTAATGATTCTACCGATTCTACCTTAGTTATACAGGCGAACAGGCGATCTCCATGAAGTACTTCAAACCCTCCTTAAGTGCAATCTATCGTGCAATCTATCCTATAATCTTTCTGGCAATTGGTTTACCATTCACCATGTTCACCATGACTTAAGTACCTAGAGGTATCGATTTGATTTGCGCGCCTCCCCACGATCACACACCATTAACTATT

Full Affymetrix probeset data:

Annotations for 1630423_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime