FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630425_at:

>probe:Drosophila_2:1630425_at:84:111; Interrogation_Position=16; Antisense; AGAATCCAAATCTTGCTCCTGACAC
>probe:Drosophila_2:1630425_at:451:417; Interrogation_Position=174; Antisense; GAGCTCCAAGGAGACGTCTCTGTAC
>probe:Drosophila_2:1630425_at:195:495; Interrogation_Position=225; Antisense; GTCAAGCGCCAACGATGATCCCGAG
>probe:Drosophila_2:1630425_at:169:605; Interrogation_Position=240; Antisense; TGATCCCGAGGATGGTCAGGAAACC
>probe:Drosophila_2:1630425_at:23:75; Interrogation_Position=257; Antisense; AGGAAACCATCTACGGCTCCAAGCC
>probe:Drosophila_2:1630425_at:406:337; Interrogation_Position=272; Antisense; GCTCCAAGCCGAATCAGTTCATCAT
>probe:Drosophila_2:1630425_at:95:117; Interrogation_Position=317; Antisense; AGCATCAGCAGCACGAATCGCACCA
>probe:Drosophila_2:1630425_at:95:237; Interrogation_Position=332; Antisense; AATCGCACCAGGAGCCGCAGTTGAG
>probe:Drosophila_2:1630425_at:580:91; Interrogation_Position=350; Antisense; AGTTGAGGAACTTTGCGGCGGCCAA
>probe:Drosophila_2:1630425_at:89:323; Interrogation_Position=391; Antisense; GCCCAACTTCTCGAGCAGAGTCAGG
>probe:Drosophila_2:1630425_at:406:421; Interrogation_Position=415; Antisense; GAGCAACTGCAGGACTTGTTTTCCA
>probe:Drosophila_2:1630425_at:255:555; Interrogation_Position=426; Antisense; GGACTTGTTTTCCAAGTTGACCCAT
>probe:Drosophila_2:1630425_at:590:719; Interrogation_Position=442; Antisense; TTGACCCATAAAACTGCCAGCCGTA
>probe:Drosophila_2:1630425_at:161:1; Interrogation_Position=460; Antisense; AGCCGTAATCCCTGGGTGTTCAATA

Paste this into a BLAST search page for me
AGAATCCAAATCTTGCTCCTGACACGAGCTCCAAGGAGACGTCTCTGTACGTCAAGCGCCAACGATGATCCCGAGTGATCCCGAGGATGGTCAGGAAACCAGGAAACCATCTACGGCTCCAAGCCGCTCCAAGCCGAATCAGTTCATCATAGCATCAGCAGCACGAATCGCACCAAATCGCACCAGGAGCCGCAGTTGAGAGTTGAGGAACTTTGCGGCGGCCAAGCCCAACTTCTCGAGCAGAGTCAGGGAGCAACTGCAGGACTTGTTTTCCAGGACTTGTTTTCCAAGTTGACCCATTTGACCCATAAAACTGCCAGCCGTAAGCCGTAATCCCTGGGTGTTCAATA

Full Affymetrix probeset data:

Annotations for 1630425_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720