Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630433_at:

>probe:Drosophila_2:1630433_at:433:599; Interrogation_Position=1197; Antisense; TGTCATTGCCGAGGGTATCATCTCC
>probe:Drosophila_2:1630433_at:614:39; Interrogation_Position=1232; Antisense; ATCTGAATCTGAACATGCCCGTGGT
>probe:Drosophila_2:1630433_at:91:465; Interrogation_Position=1255; Antisense; GTTGTGCGTCTTCAGGGAACCAAAG
>probe:Drosophila_2:1630433_at:158:255; Interrogation_Position=1275; Antisense; CAAAGTCAAGGAGGCCCGCGAACTG
>probe:Drosophila_2:1630433_at:424:383; Interrogation_Position=1294; Antisense; GAACTGATTCGTACATCTGGACTGA
>probe:Drosophila_2:1630433_at:324:585; Interrogation_Position=1311; Antisense; TGGACTGAAGATTCTGGCCCGCGAT
>probe:Drosophila_2:1630433_at:210:717; Interrogation_Position=1322; Antisense; TTCTGGCCCGCGATGATCTAGATAA
>probe:Drosophila_2:1630433_at:495:37; Interrogation_Position=1337; Antisense; ATCTAGATAAGGCTGCCGATCTCGC
>probe:Drosophila_2:1630433_at:136:511; Interrogation_Position=1363; Antisense; GTGCACTTGGCGCAAATCGTCAAAC
>probe:Drosophila_2:1630433_at:112:133; Interrogation_Position=1376; Antisense; AAATCGTCAAACTGGCCCGCGAAAT
>probe:Drosophila_2:1630433_at:536:407; Interrogation_Position=1408; Antisense; GACGTGAACTTCGAGATTCCCGATG
>probe:Drosophila_2:1630433_at:171:663; Interrogation_Position=1616; Antisense; TAAACAATGCAGGATCGAGCCGGAT
>probe:Drosophila_2:1630433_at:133:295; Interrogation_Position=1631; Antisense; CGAGCCGGATGTGTTTGAGACTTAC
>probe:Drosophila_2:1630433_at:123:715; Interrogation_Position=1755; Antisense; TTCTGACCCGCCACATTTTTAAAGA

Paste this into a BLAST search page for me
TGTCATTGCCGAGGGTATCATCTCCATCTGAATCTGAACATGCCCGTGGTGTTGTGCGTCTTCAGGGAACCAAAGCAAAGTCAAGGAGGCCCGCGAACTGGAACTGATTCGTACATCTGGACTGATGGACTGAAGATTCTGGCCCGCGATTTCTGGCCCGCGATGATCTAGATAAATCTAGATAAGGCTGCCGATCTCGCGTGCACTTGGCGCAAATCGTCAAACAAATCGTCAAACTGGCCCGCGAAATGACGTGAACTTCGAGATTCCCGATGTAAACAATGCAGGATCGAGCCGGATCGAGCCGGATGTGTTTGAGACTTACTTCTGACCCGCCACATTTTTAAAGA

Full Affymetrix probeset data:

Annotations for 1630433_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime