FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630438_at:

>probe:Drosophila_2:1630438_at:416:237; Interrogation_Position=1067; Antisense; AATCGTGGTCAAAGGGCTCCGGGCA
>probe:Drosophila_2:1630438_at:136:361; Interrogation_Position=1089; Antisense; GCAAGAAGGCGCAAGCCGGTCGCAA
>probe:Drosophila_2:1630438_at:593:109; Interrogation_Position=1126; Antisense; AGAATTACACATGCCTTAGGACACT
>probe:Drosophila_2:1630438_at:118:211; Interrogation_Position=653; Antisense; AAGAAGATCGACATGCCACGCAGCG
>probe:Drosophila_2:1630438_at:503:259; Interrogation_Position=669; Antisense; CACGCAGCGGTTACTTGGGACCCGA
>probe:Drosophila_2:1630438_at:396:315; Interrogation_Position=698; Antisense; GCCTCATCCAGCCAGTTGTTAACGG
>probe:Drosophila_2:1630438_at:475:705; Interrogation_Position=716; Antisense; TTAACGGCCGTCACTGTGGCCAAAT
>probe:Drosophila_2:1630438_at:119:317; Interrogation_Position=749; Antisense; GCCTCAGTCGGCAAATTCCAAAACA
>probe:Drosophila_2:1630438_at:294:73; Interrogation_Position=792; Antisense; AGGCACGTGGTCTGGGCATTAAAGA
>probe:Drosophila_2:1630438_at:328:709; Interrogation_Position=810; Antisense; TTAAAGAGCTGATTCCCGGCGGCAA
>probe:Drosophila_2:1630438_at:716:501; Interrogation_Position=844; Antisense; GTCGCATATCACACAAACGCCGGAG
>probe:Drosophila_2:1630438_at:526:371; Interrogation_Position=868; Antisense; GAAGGAGGCCAACCTGGATCTCATC
>probe:Drosophila_2:1630438_at:381:587; Interrogation_Position=882; Antisense; TGGATCTCATCAAGAGCGTGCTGAA
>probe:Drosophila_2:1630438_at:102:251; Interrogation_Position=958; Antisense; CAATCGCTTGGCACGCGAAGCAGAG

Paste this into a BLAST search page for me
AATCGTGGTCAAAGGGCTCCGGGCAGCAAGAAGGCGCAAGCCGGTCGCAAAGAATTACACATGCCTTAGGACACTAAGAAGATCGACATGCCACGCAGCGCACGCAGCGGTTACTTGGGACCCGAGCCTCATCCAGCCAGTTGTTAACGGTTAACGGCCGTCACTGTGGCCAAATGCCTCAGTCGGCAAATTCCAAAACAAGGCACGTGGTCTGGGCATTAAAGATTAAAGAGCTGATTCCCGGCGGCAAGTCGCATATCACACAAACGCCGGAGGAAGGAGGCCAACCTGGATCTCATCTGGATCTCATCAAGAGCGTGCTGAACAATCGCTTGGCACGCGAAGCAGAG

Full Affymetrix probeset data:

Annotations for 1630438_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720