FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630440_at:

>probe:Drosophila_2:1630440_at:191:551; Interrogation_Position=417; Antisense; GGAGTTCCTTAACTTTCAGCTGGAC
>probe:Drosophila_2:1630440_at:242:671; Interrogation_Position=443; Antisense; TACGGGTGCTTATTCTCGACGATGA
>probe:Drosophila_2:1630440_at:461:627; Interrogation_Position=486; Antisense; TGCCATCAATTGCTGCGGAGTCGCT
>probe:Drosophila_2:1630440_at:26:621; Interrogation_Position=520; Antisense; TGCGGCATTTCCACTTACGACTTAA
>probe:Drosophila_2:1630440_at:645:705; Interrogation_Position=534; Antisense; TTACGACTTAATTACGGCCTCCACA
>probe:Drosophila_2:1630440_at:30:309; Interrogation_Position=554; Antisense; CCACAGCTTGTATCTATCGGGATCA
>probe:Drosophila_2:1630440_at:139:685; Interrogation_Position=568; Antisense; TATCGGGATCACGTCTTCCTGAATC
>probe:Drosophila_2:1630440_at:704:629; Interrogation_Position=584; Antisense; TCCTGAATCCCAGTGCCAAGGTTGA
>probe:Drosophila_2:1630440_at:694:551; Interrogation_Position=609; Antisense; GGAGCTGCTCTGGAAGCATCGCAAC
>probe:Drosophila_2:1630440_at:9:29; Interrogation_Position=704; Antisense; ATACCTTTGAACAGATCGCCCAGTG
>probe:Drosophila_2:1630440_at:372:115; Interrogation_Position=731; Antisense; AGCAGTGCGGATATCTCAGTCCAGC
>probe:Drosophila_2:1630440_at:583:587; Interrogation_Position=773; Antisense; TGGATTACACCCTGGCCATTAACAA
>probe:Drosophila_2:1630440_at:374:385; Interrogation_Position=808; Antisense; GAACTAGTCAAAGGCGTGCTCACGA
>probe:Drosophila_2:1630440_at:303:205; Interrogation_Position=872; Antisense; AAGCCGAGACCGCTCTAGAAGATCA

Paste this into a BLAST search page for me
GGAGTTCCTTAACTTTCAGCTGGACTACGGGTGCTTATTCTCGACGATGATGCCATCAATTGCTGCGGAGTCGCTTGCGGCATTTCCACTTACGACTTAATTACGACTTAATTACGGCCTCCACACCACAGCTTGTATCTATCGGGATCATATCGGGATCACGTCTTCCTGAATCTCCTGAATCCCAGTGCCAAGGTTGAGGAGCTGCTCTGGAAGCATCGCAACATACCTTTGAACAGATCGCCCAGTGAGCAGTGCGGATATCTCAGTCCAGCTGGATTACACCCTGGCCATTAACAAGAACTAGTCAAAGGCGTGCTCACGAAAGCCGAGACCGCTCTAGAAGATCA

Full Affymetrix probeset data:

Annotations for 1630440_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720