FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630441_at:

>probe:Drosophila_2:1630441_at:668:91; Interrogation_Position=1080; Antisense; AGTTTTGGCCACATCCAGGATCATC
>probe:Drosophila_2:1630441_at:326:545; Interrogation_Position=1097; Antisense; GGATCATCACTCCTTTGAGCACCAG
>probe:Drosophila_2:1630441_at:491:111; Interrogation_Position=1120; Antisense; AGCACTATGCAATCCTTTCTGTCTG
>probe:Drosophila_2:1630441_at:232:307; Interrogation_Position=1133; Antisense; CCTTTCTGTCTGTTCGGATGCCGAG
>probe:Drosophila_2:1630441_at:562:447; Interrogation_Position=1149; Antisense; GATGCCGAGCACTACTGAGATGGTC
>probe:Drosophila_2:1630441_at:357:157; Interrogation_Position=1207; Antisense; ACACAAGCATTTAGCACCACTCAAA
>probe:Drosophila_2:1630441_at:183:125; Interrogation_Position=1222; Antisense; ACCACTCAAAAATCCACTGCAACTG
>probe:Drosophila_2:1630441_at:519:211; Interrogation_Position=670; Antisense; AAGTTTGCTACCATTCCGAAGAAAG
>probe:Drosophila_2:1630441_at:398:483; Interrogation_Position=694; Antisense; GTATACATAATGCTGGCCACTCCTG
>probe:Drosophila_2:1630441_at:101:295; Interrogation_Position=772; Antisense; CGAATCACGACGACGGCCAGGATGA
>probe:Drosophila_2:1630441_at:199:519; Interrogation_Position=856; Antisense; GTGGCTAATCCCATGGTTTCCGTTT
>probe:Drosophila_2:1630441_at:619:479; Interrogation_Position=871; Antisense; GTTTCCGTTTCCCAGGCTATAGATG
>probe:Drosophila_2:1630441_at:82:519; Interrogation_Position=922; Antisense; GTGGGTCACGATTACGGCGAGATAA
>probe:Drosophila_2:1630441_at:152:217; Interrogation_Position=977; Antisense; AAGTTGGTCGTGTCACAGAGCCCTA

Paste this into a BLAST search page for me
AGTTTTGGCCACATCCAGGATCATCGGATCATCACTCCTTTGAGCACCAGAGCACTATGCAATCCTTTCTGTCTGCCTTTCTGTCTGTTCGGATGCCGAGGATGCCGAGCACTACTGAGATGGTCACACAAGCATTTAGCACCACTCAAAACCACTCAAAAATCCACTGCAACTGAAGTTTGCTACCATTCCGAAGAAAGGTATACATAATGCTGGCCACTCCTGCGAATCACGACGACGGCCAGGATGAGTGGCTAATCCCATGGTTTCCGTTTGTTTCCGTTTCCCAGGCTATAGATGGTGGGTCACGATTACGGCGAGATAAAAGTTGGTCGTGTCACAGAGCCCTA

Full Affymetrix probeset data:

Annotations for 1630441_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720