FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630442_at:

>probe:Drosophila_2:1630442_at:588:195; Interrogation_Position=275; Antisense; AACTGGAGCATCAGCTGGGCCTGAA
>probe:Drosophila_2:1630442_at:468:263; Interrogation_Position=309; Antisense; CAGCGGTCTGGCTTACAGGCAGAAC
>probe:Drosophila_2:1630442_at:286:567; Interrogation_Position=326; Antisense; GGCAGAACCACGCTGATGACGAACA
>probe:Drosophila_2:1630442_at:256:455; Interrogation_Position=376; Antisense; GATCACGTTCAGGATGAGCTGCCCA
>probe:Drosophila_2:1630442_at:605:69; Interrogation_Position=428; Antisense; AGGCTGGTGCCATTATGGTGCCCGA
>probe:Drosophila_2:1630442_at:312:507; Interrogation_Position=445; Antisense; GTGCCCGATGGCATTATCGAGATCG
>probe:Drosophila_2:1630442_at:497:521; Interrogation_Position=559; Antisense; GTGGCTCTTATGGAGCGATCCGCCT
>probe:Drosophila_2:1630442_at:658:449; Interrogation_Position=575; Antisense; GATCCGCCTCATCCGTTGATGAAAT
>probe:Drosophila_2:1630442_at:536:165; Interrogation_Position=596; Antisense; AAATCGAGGAAGAGCGCGCCAACCG
>probe:Drosophila_2:1630442_at:664:517; Interrogation_Position=622; Antisense; GTGGTAGTTCGTCGCCGCAAGAACA
>probe:Drosophila_2:1630442_at:191:185; Interrogation_Position=643; Antisense; AACAACGGACGCAGGAACATTCGCC
>probe:Drosophila_2:1630442_at:326:349; Interrogation_Position=740; Antisense; GCAGGCGCAATGTACGCGTCATTCG
>probe:Drosophila_2:1630442_at:430:359; Interrogation_Position=776; Antisense; GCAACCGTAGGCGTGGCAACCAGAG
>probe:Drosophila_2:1630442_at:730:295; Interrogation_Position=805; Antisense; CGCGGACAGGTCGTATTCCAGGGTT

Paste this into a BLAST search page for me
AACTGGAGCATCAGCTGGGCCTGAACAGCGGTCTGGCTTACAGGCAGAACGGCAGAACCACGCTGATGACGAACAGATCACGTTCAGGATGAGCTGCCCAAGGCTGGTGCCATTATGGTGCCCGAGTGCCCGATGGCATTATCGAGATCGGTGGCTCTTATGGAGCGATCCGCCTGATCCGCCTCATCCGTTGATGAAATAAATCGAGGAAGAGCGCGCCAACCGGTGGTAGTTCGTCGCCGCAAGAACAAACAACGGACGCAGGAACATTCGCCGCAGGCGCAATGTACGCGTCATTCGGCAACCGTAGGCGTGGCAACCAGAGCGCGGACAGGTCGTATTCCAGGGTT

Full Affymetrix probeset data:

Annotations for 1630442_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720