FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630445_at:

>probe:Drosophila_2:1630445_at:112:387; Interrogation_Position=2348; Antisense; GAAAATGAAACCCTTGGCTCCGGCG
>probe:Drosophila_2:1630445_at:360:391; Interrogation_Position=2378; Antisense; GAAACCCAAGGCTCTTAGGCTGCTG
>probe:Drosophila_2:1630445_at:176:681; Interrogation_Position=2393; Antisense; TAGGCTGCTGGAACCTCGATTCGAG
>probe:Drosophila_2:1630445_at:499:175; Interrogation_Position=2433; Antisense; AAACGTCGTCCCAAGATGTCCAAGG
>probe:Drosophila_2:1630445_at:294:103; Interrogation_Position=2465; Antisense; AGAGCGGGCCAAACTGCTGCACAAG
>probe:Drosophila_2:1630445_at:313:95; Interrogation_Position=2531; Antisense; AGATACGTCCTTCGTTCAGATGCTT
>probe:Drosophila_2:1630445_at:280:53; Interrogation_Position=2550; Antisense; ATGCTTAGGCTCAAACAGACCCTGC
>probe:Drosophila_2:1630445_at:44:273; Interrogation_Position=2609; Antisense; CATTTACCAGGAGGCATCCGTGCAA
>probe:Drosophila_2:1630445_at:162:47; Interrogation_Position=2624; Antisense; ATCCGTGCAACAGGGCGAGCTCAAT
>probe:Drosophila_2:1630445_at:718:651; Interrogation_Position=2644; Antisense; TCAATGAGCTGTCCCGGGCCAAAAA
>probe:Drosophila_2:1630445_at:139:373; Interrogation_Position=2675; Antisense; GAAGTTCTAGGCTCGACTTTGAATT
>probe:Drosophila_2:1630445_at:397:387; Interrogation_Position=2774; Antisense; GAAATCGGCCTTCACAGTTTTTATA
>probe:Drosophila_2:1630445_at:540:703; Interrogation_Position=2800; Antisense; TTATGCAAAGCTACTAACCCAGATT
>probe:Drosophila_2:1630445_at:267:613; Interrogation_Position=2850; Antisense; TGAAACATCTCATCATTGCTCTTTG

Paste this into a BLAST search page for me
GAAAATGAAACCCTTGGCTCCGGCGGAAACCCAAGGCTCTTAGGCTGCTGTAGGCTGCTGGAACCTCGATTCGAGAAACGTCGTCCCAAGATGTCCAAGGAGAGCGGGCCAAACTGCTGCACAAGAGATACGTCCTTCGTTCAGATGCTTATGCTTAGGCTCAAACAGACCCTGCCATTTACCAGGAGGCATCCGTGCAAATCCGTGCAACAGGGCGAGCTCAATTCAATGAGCTGTCCCGGGCCAAAAAGAAGTTCTAGGCTCGACTTTGAATTGAAATCGGCCTTCACAGTTTTTATATTATGCAAAGCTACTAACCCAGATTTGAAACATCTCATCATTGCTCTTTG

Full Affymetrix probeset data:

Annotations for 1630445_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720