FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630447_at:

>probe:Drosophila_2:1630447_at:699:127; Interrogation_Position=3405; Antisense; ACTCCAGTTTGCAGTTTATAAGCCG
>probe:Drosophila_2:1630447_at:400:213; Interrogation_Position=3430; Antisense; AAGAGAGATCTTATCCGATCCGCTC
>probe:Drosophila_2:1630447_at:659:449; Interrogation_Position=3446; Antisense; GATCCGCTCCAGAGTTAAAGCATGT
>probe:Drosophila_2:1630447_at:274:603; Interrogation_Position=3483; Antisense; TGTTGTCGGTGTTATGTGCGTTATA
>probe:Drosophila_2:1630447_at:649:687; Interrogation_Position=3504; Antisense; TATATAGGTTTCGAGACCCTCCACT
>probe:Drosophila_2:1630447_at:42:445; Interrogation_Position=3545; Antisense; GATGCATCCCGATTCAGATCCAGAA
>probe:Drosophila_2:1630447_at:670:425; Interrogation_Position=3687; Antisense; GAGAGTAACCATTTTGCGACCCTTG
>probe:Drosophila_2:1630447_at:670:619; Interrogation_Position=3701; Antisense; TGCGACCCTTGACGATTTCATACAT
>probe:Drosophila_2:1630447_at:532:59; Interrogation_Position=3745; Antisense; ATGTTGCTAGCCATATACTACGAGT
>probe:Drosophila_2:1630447_at:163:21; Interrogation_Position=3817; Antisense; ATATTTTTTCTTAGCGCTGGTTCCA
>probe:Drosophila_2:1630447_at:599:323; Interrogation_Position=3830; Antisense; GCGCTGGTTCCATCTGAATACTGAA
>probe:Drosophila_2:1630447_at:561:365; Interrogation_Position=3845; Antisense; GAATACTGAACAAAGCTGGTCGCAA
>probe:Drosophila_2:1630447_at:253:97; Interrogation_Position=3908; Antisense; AGATCGAGTTCTACGTGTATTGGAT
>probe:Drosophila_2:1630447_at:16:691; Interrogation_Position=3943; Antisense; TATTGTAGGTGTCCATCTCCAGATC

Paste this into a BLAST search page for me
ACTCCAGTTTGCAGTTTATAAGCCGAAGAGAGATCTTATCCGATCCGCTCGATCCGCTCCAGAGTTAAAGCATGTTGTTGTCGGTGTTATGTGCGTTATATATATAGGTTTCGAGACCCTCCACTGATGCATCCCGATTCAGATCCAGAAGAGAGTAACCATTTTGCGACCCTTGTGCGACCCTTGACGATTTCATACATATGTTGCTAGCCATATACTACGAGTATATTTTTTCTTAGCGCTGGTTCCAGCGCTGGTTCCATCTGAATACTGAAGAATACTGAACAAAGCTGGTCGCAAAGATCGAGTTCTACGTGTATTGGATTATTGTAGGTGTCCATCTCCAGATC

Full Affymetrix probeset data:

Annotations for 1630447_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720