FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630448_at:

>probe:Drosophila_2:1630448_at:92:173; Interrogation_Position=1461; Antisense; AAAGATCCTCAATCACATTCGCTAC
>probe:Drosophila_2:1630448_at:206:277; Interrogation_Position=1528; Antisense; CTTATTAAGCCGGAGCCCATGTGGG
>probe:Drosophila_2:1630448_at:580:185; Interrogation_Position=1561; Antisense; AACAAGTCCGGTCAAGCGGCCATGG
>probe:Drosophila_2:1630448_at:605:45; Interrogation_Position=1599; Antisense; ATCCGAGGACGATCAGGGCGAGCAA
>probe:Drosophila_2:1630448_at:63:295; Interrogation_Position=1617; Antisense; CGAGCAAGCTGTGTGCGAGCACTGT
>probe:Drosophila_2:1630448_at:688:357; Interrogation_Position=1658; Antisense; GCAAATGGCGCTACGAACGACACAT
>probe:Drosophila_2:1630448_at:255:399; Interrogation_Position=1676; Antisense; GACACATTGCCTCTTGCAGGAGATC
>probe:Drosophila_2:1630448_at:103:41; Interrogation_Position=1698; Antisense; ATCTGGAGCTGGCAAGTCAGTCGAA
>probe:Drosophila_2:1630448_at:248:379; Interrogation_Position=1732; Antisense; GAAGCCTTGTTGAACCATCTGCGAG
>probe:Drosophila_2:1630448_at:112:527; Interrogation_Position=1759; Antisense; GGGCACATGCGAATGAACGCCATCT
>probe:Drosophila_2:1630448_at:333:137; Interrogation_Position=1789; Antisense; ACGATGCAACGTGAAAAGCCTTAGG
>probe:Drosophila_2:1630448_at:325:219; Interrogation_Position=1832; Antisense; AAGTCGGTCCATCGTTTTGCAAATA
>probe:Drosophila_2:1630448_at:497:493; Interrogation_Position=1877; Antisense; GTAAGTTTTCAAATCCTTGTGCAAA
>probe:Drosophila_2:1630448_at:718:661; Interrogation_Position=1927; Antisense; TAACACATACGACTTACATGCCTAT

Paste this into a BLAST search page for me
AAAGATCCTCAATCACATTCGCTACCTTATTAAGCCGGAGCCCATGTGGGAACAAGTCCGGTCAAGCGGCCATGGATCCGAGGACGATCAGGGCGAGCAACGAGCAAGCTGTGTGCGAGCACTGTGCAAATGGCGCTACGAACGACACATGACACATTGCCTCTTGCAGGAGATCATCTGGAGCTGGCAAGTCAGTCGAAGAAGCCTTGTTGAACCATCTGCGAGGGGCACATGCGAATGAACGCCATCTACGATGCAACGTGAAAAGCCTTAGGAAGTCGGTCCATCGTTTTGCAAATAGTAAGTTTTCAAATCCTTGTGCAAATAACACATACGACTTACATGCCTAT

Full Affymetrix probeset data:

Annotations for 1630448_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720