Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630450_s_at:

>probe:Drosophila_2:1630450_s_at:93:1; Interrogation_Position=109; Antisense; CGTACTTATCCTGTGCCTAAACCGT
>probe:Drosophila_2:1630450_s_at:177:705; Interrogation_Position=114; Antisense; TTATCCTGTGCCTAAACCGTCGAGC
>probe:Drosophila_2:1630450_s_at:676:305; Interrogation_Position=118; Antisense; CCTGTGCCTAAACCGTCGAGCGAAA
>probe:Drosophila_2:1630450_s_at:48:63; Interrogation_Position=13; Antisense; ATGTGCATCATACTGCGAACGCTAG
>probe:Drosophila_2:1630450_s_at:722:669; Interrogation_Position=23; Antisense; TACTGCGAACGCTAGTTAAGGAGCA
>probe:Drosophila_2:1630450_s_at:25:133; Interrogation_Position=31; Antisense; ACGCTAGTTAAGGAGCAGTGCTTCA
>probe:Drosophila_2:1630450_s_at:36:351; Interrogation_Position=45; Antisense; GCAGTGCTTCAATTGCTACTTCGAT
>probe:Drosophila_2:1630450_s_at:450:509; Interrogation_Position=48; Antisense; GTGCTTCAATTGCTACTTCGATGGA
>probe:Drosophila_2:1630450_s_at:38:275; Interrogation_Position=51; Antisense; CTTCAATTGCTACTTCGATGGAAAT
>probe:Drosophila_2:1630450_s_at:259:145; Interrogation_Position=62; Antisense; ACTTCGATGGAAATGTAACTGTTAC
>probe:Drosophila_2:1630450_s_at:12:491; Interrogation_Position=76; Antisense; GTAACTGTTACGTACTGTGTTCGCG
>probe:Drosophila_2:1630450_s_at:343:143; Interrogation_Position=79; Antisense; ACTGTTACGTACTGTGTTCGCGATT
>probe:Drosophila_2:1630450_s_at:541:707; Interrogation_Position=83; Antisense; TTACGTACTGTGTTCGCGATTTCCC
>probe:Drosophila_2:1630450_s_at:487:465; Interrogation_Position=93; Antisense; TGTTCGCGATTTCCCCCGTACTTAT

Paste this into a BLAST search page for me
CGTACTTATCCTGTGCCTAAACCGTTTATCCTGTGCCTAAACCGTCGAGCCCTGTGCCTAAACCGTCGAGCGAAAATGTGCATCATACTGCGAACGCTAGTACTGCGAACGCTAGTTAAGGAGCAACGCTAGTTAAGGAGCAGTGCTTCAGCAGTGCTTCAATTGCTACTTCGATGTGCTTCAATTGCTACTTCGATGGACTTCAATTGCTACTTCGATGGAAATACTTCGATGGAAATGTAACTGTTACGTAACTGTTACGTACTGTGTTCGCGACTGTTACGTACTGTGTTCGCGATTTTACGTACTGTGTTCGCGATTTCCCTGTTCGCGATTTCCCCCGTACTTAT

Full Affymetrix probeset data:

Annotations for 1630450_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime