Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630451_at:

>probe:Drosophila_2:1630451_at:139:501; Interrogation_Position=152; Antisense; GTCGTAACGCGCACGAGTGGGCAAA
>probe:Drosophila_2:1630451_at:367:103; Interrogation_Position=180; Antisense; AGAGCGTGGCCGGATTCGCCTCGAT
>probe:Drosophila_2:1630451_at:581:425; Interrogation_Position=209; Antisense; GAGAGCCTGGCCAGCGAGTCCAAGT
>probe:Drosophila_2:1630451_at:361:487; Interrogation_Position=283; Antisense; GTACCAGTGGATCGAGTTCTCCGTG
>probe:Drosophila_2:1630451_at:1:219; Interrogation_Position=335; Antisense; AAGTACGTGTCCAAGCAGCTTCTGG
>probe:Drosophila_2:1630451_at:382:115; Interrogation_Position=351; Antisense; AGCTTCTGGCGGACTTCAACAAACT
>probe:Drosophila_2:1630451_at:175:111; Interrogation_Position=383; Antisense; AGCAAATCCTACCTGGTGGGCCACT
>probe:Drosophila_2:1630451_at:83:499; Interrogation_Position=431; Antisense; GTCTACTATGCCATCTACGATCTTG
>probe:Drosophila_2:1630451_at:74:613; Interrogation_Position=456; Antisense; TGAAATCCCTTTCGCCGGTGGACAA
>probe:Drosophila_2:1630451_at:406:79; Interrogation_Position=483; Antisense; AGGTATATTTGAATCTCTCCCGCTG
>probe:Drosophila_2:1630451_at:116:591; Interrogation_Position=506; Antisense; TGGTTCGATCACCTCCAGAATCGCG
>probe:Drosophila_2:1630451_at:132:265; Interrogation_Position=521; Antisense; CAGAATCGCGCGGATGTGCACCAGG
>probe:Drosophila_2:1630451_at:447:83; Interrogation_Position=543; Antisense; AGGGCGAGCCACTGCTGAACTTCAC
>probe:Drosophila_2:1630451_at:442:13; Interrogation_Position=636; Antisense; ATTCACATCCAGTCACGAATGCGAC

Paste this into a BLAST search page for me
GTCGTAACGCGCACGAGTGGGCAAAAGAGCGTGGCCGGATTCGCCTCGATGAGAGCCTGGCCAGCGAGTCCAAGTGTACCAGTGGATCGAGTTCTCCGTGAAGTACGTGTCCAAGCAGCTTCTGGAGCTTCTGGCGGACTTCAACAAACTAGCAAATCCTACCTGGTGGGCCACTGTCTACTATGCCATCTACGATCTTGTGAAATCCCTTTCGCCGGTGGACAAAGGTATATTTGAATCTCTCCCGCTGTGGTTCGATCACCTCCAGAATCGCGCAGAATCGCGCGGATGTGCACCAGGAGGGCGAGCCACTGCTGAACTTCACATTCACATCCAGTCACGAATGCGAC

Full Affymetrix probeset data:

Annotations for 1630451_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime