FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630453_at:

>probe:Drosophila_2:1630453_at:364:219; Interrogation_Position=146; Antisense; AAGTCCGCTTCAATTTCATCCTATT
>probe:Drosophila_2:1630453_at:422:687; Interrogation_Position=167; Antisense; TATTTGGAGCCGTAATAGCCGCTGT
>probe:Drosophila_2:1630453_at:121:613; Interrogation_Position=17; Antisense; TGACAACTTTTTGGTGCGACTCGCA
>probe:Drosophila_2:1630453_at:692:493; Interrogation_Position=178; Antisense; GTAATAGCCGCTGTTCGCTTGGCTC
>probe:Drosophila_2:1630453_at:571:727; Interrogation_Position=196; Antisense; TTGGCTCCCATAGTCCTGAAGCATT
>probe:Drosophila_2:1630453_at:646:503; Interrogation_Position=208; Antisense; GTCCTGAAGCATTTAAATACGGCGT
>probe:Drosophila_2:1630453_at:662:135; Interrogation_Position=282; Antisense; ACGTTATCAATTACCTAGTTGTTCA
>probe:Drosophila_2:1630453_at:195:167; Interrogation_Position=320; Antisense; AAATCCTAAGCAACTGGCACGCGAA
>probe:Drosophila_2:1630453_at:179:255; Interrogation_Position=330; Antisense; CAACTGGCACGCGAAATGCATTTAT
>probe:Drosophila_2:1630453_at:541:403; Interrogation_Position=34; Antisense; GACTCGCACGTTTTTCTTTGTAAAT
>probe:Drosophila_2:1630453_at:278:183; Interrogation_Position=357; Antisense; AAAAGCACTCTGACCCATTTGATGT
>probe:Drosophila_2:1630453_at:672:411; Interrogation_Position=368; Antisense; GACCCATTTGATGTCTTTTAAAGTT
>probe:Drosophila_2:1630453_at:453:167; Interrogation_Position=409; Antisense; AAATGTTTGGTAACTGTCGAGCGAA
>probe:Drosophila_2:1630453_at:436:655; Interrogation_Position=76; Antisense; TAATCAAGGATGTTCCGCCTGCAGC

Paste this into a BLAST search page for me
AAGTCCGCTTCAATTTCATCCTATTTATTTGGAGCCGTAATAGCCGCTGTTGACAACTTTTTGGTGCGACTCGCAGTAATAGCCGCTGTTCGCTTGGCTCTTGGCTCCCATAGTCCTGAAGCATTGTCCTGAAGCATTTAAATACGGCGTACGTTATCAATTACCTAGTTGTTCAAAATCCTAAGCAACTGGCACGCGAACAACTGGCACGCGAAATGCATTTATGACTCGCACGTTTTTCTTTGTAAATAAAAGCACTCTGACCCATTTGATGTGACCCATTTGATGTCTTTTAAAGTTAAATGTTTGGTAACTGTCGAGCGAATAATCAAGGATGTTCCGCCTGCAGC

Full Affymetrix probeset data:

Annotations for 1630453_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720