Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630454_at:

>probe:Drosophila_2:1630454_at:153:583; Interrogation_Position=109; Antisense; TGGCGACTTTCAGCGATTTGTGGCG
>probe:Drosophila_2:1630454_at:456:19; Interrogation_Position=124; Antisense; ATTTGTGGCGGTTGGCGACCCACTC
>probe:Drosophila_2:1630454_at:576:145; Interrogation_Position=145; Antisense; ACTCCTGTTTATGCGGTCATCGGCA
>probe:Drosophila_2:1630454_at:595:41; Interrogation_Position=163; Antisense; ATCGGCATCTGCCTGATCCTGTATC
>probe:Drosophila_2:1630454_at:179:483; Interrogation_Position=183; Antisense; GTATCCCCACAATCTGTGGCTGAGT
>probe:Drosophila_2:1630454_at:203:681; Interrogation_Position=208; Antisense; TATGTGGCCGGGATGTTCCTGATAC
>probe:Drosophila_2:1630454_at:661:547; Interrogation_Position=218; Antisense; GGATGTTCCTGATACTCCTCGGACT
>probe:Drosophila_2:1630454_at:199:621; Interrogation_Position=260; Antisense; TGCTCCGATTCAGCGCCTCGAAGGA
>probe:Drosophila_2:1630454_at:661:221; Interrogation_Position=28; Antisense; AAGTGGCTTGTGACTATCTTCCTGC
>probe:Drosophila_2:1630454_at:57:631; Interrogation_Position=293; Antisense; TCCTGCCGCAGTGCGACTTTGAAAA
>probe:Drosophila_2:1630454_at:567:513; Interrogation_Position=319; Antisense; GTGTCGAGCTTTGTGGATACCATGG
>probe:Drosophila_2:1630454_at:597:57; Interrogation_Position=347; Antisense; ATGATTTCGCGGAGATTGGTGCCAC
>probe:Drosophila_2:1630454_at:679:685; Interrogation_Position=42; Antisense; TATCTTCCTGCAACTTCAGTGCGCA
>probe:Drosophila_2:1630454_at:508:299; Interrogation_Position=420; Antisense; CGCCCTAGACGACGATGTTTGCTAA

Paste this into a BLAST search page for me
TGGCGACTTTCAGCGATTTGTGGCGATTTGTGGCGGTTGGCGACCCACTCACTCCTGTTTATGCGGTCATCGGCAATCGGCATCTGCCTGATCCTGTATCGTATCCCCACAATCTGTGGCTGAGTTATGTGGCCGGGATGTTCCTGATACGGATGTTCCTGATACTCCTCGGACTTGCTCCGATTCAGCGCCTCGAAGGAAAGTGGCTTGTGACTATCTTCCTGCTCCTGCCGCAGTGCGACTTTGAAAAGTGTCGAGCTTTGTGGATACCATGGATGATTTCGCGGAGATTGGTGCCACTATCTTCCTGCAACTTCAGTGCGCACGCCCTAGACGACGATGTTTGCTAA

Full Affymetrix probeset data:

Annotations for 1630454_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime