FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630455_at:

>probe:Drosophila_2:1630455_at:447:717; Interrogation_Position=162; Antisense; TTCGCAAGCTTATCAAGGATGGTCT
>probe:Drosophila_2:1630455_at:334:605; Interrogation_Position=186; Antisense; TGATCATCAAGAAGCCCGTCGTGGT
>probe:Drosophila_2:1630455_at:661:623; Interrogation_Position=215; Antisense; TCCCGTTACCGTGTGCGCAAAAACA
>probe:Drosophila_2:1630455_at:15:219; Interrogation_Position=254; Antisense; AAGGGACGTCACTGCGGATTCGGAA
>probe:Drosophila_2:1630455_at:611:657; Interrogation_Position=283; Antisense; TAAGGGTACTGCGAACGCCCGCATG
>probe:Drosophila_2:1630455_at:636:49; Interrogation_Position=305; Antisense; ATGCCTACCAAGCTGCTGTGGATGC
>probe:Drosophila_2:1630455_at:257:641; Interrogation_Position=343; Antisense; TCTGCGCCGCCTGTTGAAGAAGTAC
>probe:Drosophila_2:1630455_at:730:93; Interrogation_Position=381; Antisense; AGATTGACAGGCACCTGTACCACGA
>probe:Drosophila_2:1630455_at:648:673; Interrogation_Position=398; Antisense; TACCACGACCTGTACATGAAGTGCA
>probe:Drosophila_2:1630455_at:467:107; Interrogation_Position=438; Antisense; AGAACAAGCGCGTCCTCATGGAGTA
>probe:Drosophila_2:1630455_at:459:327; Interrogation_Position=558; Antisense; GCGAGGAGCGTATTGCCACCAAGAA
>probe:Drosophila_2:1630455_at:255:647; Interrogation_Position=591; Antisense; TCATCGCCCTGCATGCTAAGGAGGA
>probe:Drosophila_2:1630455_at:305:281; Interrogation_Position=663; Antisense; CTCGCTAGTCGAGGAACTCCATATT
>probe:Drosophila_2:1630455_at:130:155; Interrogation_Position=715; Antisense; ACACCTTTAGTTTGGCCGAAATGAT

Paste this into a BLAST search page for me
TTCGCAAGCTTATCAAGGATGGTCTTGATCATCAAGAAGCCCGTCGTGGTTCCCGTTACCGTGTGCGCAAAAACAAAGGGACGTCACTGCGGATTCGGAATAAGGGTACTGCGAACGCCCGCATGATGCCTACCAAGCTGCTGTGGATGCTCTGCGCCGCCTGTTGAAGAAGTACAGATTGACAGGCACCTGTACCACGATACCACGACCTGTACATGAAGTGCAAGAACAAGCGCGTCCTCATGGAGTAGCGAGGAGCGTATTGCCACCAAGAATCATCGCCCTGCATGCTAAGGAGGACTCGCTAGTCGAGGAACTCCATATTACACCTTTAGTTTGGCCGAAATGAT

Full Affymetrix probeset data:

Annotations for 1630455_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720