Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630456_at:

>probe:Drosophila_2:1630456_at:486:377; Interrogation_Position=1342; Antisense; GAAGCACAATGTCGCGAATATCGTT
>probe:Drosophila_2:1630456_at:465:57; Interrogation_Position=1399; Antisense; ATGTTTTTGCCAGGCCAACATCAAT
>probe:Drosophila_2:1630456_at:503:647; Interrogation_Position=1433; Antisense; TCATCGATGTTTTTCTTGCTCCTGG
>probe:Drosophila_2:1630456_at:497:275; Interrogation_Position=1447; Antisense; CTTGCTCCTGGTTCGTTACAATACA
>probe:Drosophila_2:1630456_at:702:667; Interrogation_Position=1473; Antisense; TACTAAACACACTTCGATGTCGTTA
>probe:Drosophila_2:1630456_at:663:655; Interrogation_Position=1563; Antisense; TAAGTTCACATTGAGCTCATTGGCT
>probe:Drosophila_2:1630456_at:546:117; Interrogation_Position=1576; Antisense; AGCTCATTGGCTTTGGACTGGTCAC
>probe:Drosophila_2:1630456_at:258:665; Interrogation_Position=1623; Antisense; TACTATATACTACTACTCCTTGGGA
>probe:Drosophila_2:1630456_at:301:703; Interrogation_Position=1649; Antisense; TTACTATATACTACGGGCCCTTTGA
>probe:Drosophila_2:1630456_at:570:655; Interrogation_Position=1721; Antisense; TAATCACACGCCTTGTTCGTTTTTG
>probe:Drosophila_2:1630456_at:467:235; Interrogation_Position=1758; Antisense; AATCGCTAGGTGCAATTGTTTCTAA
>probe:Drosophila_2:1630456_at:207:541; Interrogation_Position=1801; Antisense; GGTTACTACAGACCACTGTACGGTT
>probe:Drosophila_2:1630456_at:28:253; Interrogation_Position=1843; Antisense; CAAAAGTTAGCCCACTCTCAAATCA
>probe:Drosophila_2:1630456_at:639:425; Interrogation_Position=1891; Antisense; GAGATCAAACATCAAGTCCCCACCA

Paste this into a BLAST search page for me
GAAGCACAATGTCGCGAATATCGTTATGTTTTTGCCAGGCCAACATCAATTCATCGATGTTTTTCTTGCTCCTGGCTTGCTCCTGGTTCGTTACAATACATACTAAACACACTTCGATGTCGTTATAAGTTCACATTGAGCTCATTGGCTAGCTCATTGGCTTTGGACTGGTCACTACTATATACTACTACTCCTTGGGATTACTATATACTACGGGCCCTTTGATAATCACACGCCTTGTTCGTTTTTGAATCGCTAGGTGCAATTGTTTCTAAGGTTACTACAGACCACTGTACGGTTCAAAAGTTAGCCCACTCTCAAATCAGAGATCAAACATCAAGTCCCCACCA

Full Affymetrix probeset data:

Annotations for 1630456_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime