Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630457_s_at:

>probe:Drosophila_2:1630457_s_at:28:555; Interrogation_Position=470; Antisense; GGAGCCCAGTGCTGCAAGATGTACT
>probe:Drosophila_2:1630457_s_at:710:441; Interrogation_Position=487; Antisense; GATGTACTAACTAATCACTTTACGA
>probe:Drosophila_2:1630457_s_at:31:277; Interrogation_Position=504; Antisense; CTTTACGAAATTGTGTCTTGCGATA
>probe:Drosophila_2:1630457_s_at:541:327; Interrogation_Position=523; Antisense; GCGATATAATGAGCTTAACTGCGAA
>probe:Drosophila_2:1630457_s_at:441:57; Interrogation_Position=561; Antisense; ATGATGTCAGCCGTAGTTTATTTAG
>probe:Drosophila_2:1630457_s_at:21:479; Interrogation_Position=576; Antisense; GTTTATTTAGACACGCACACACTCA
>probe:Drosophila_2:1630457_s_at:439:357; Interrogation_Position=590; Antisense; GCACACACTCAGAAGTCGGCGATAT
>probe:Drosophila_2:1630457_s_at:35:667; Interrogation_Position=638; Antisense; TACACATGGGTACTATCAACTTGAA
>probe:Drosophila_2:1630457_s_at:42:561; Interrogation_Position=722; Antisense; GGAAACGCCACTGATTCATATTTGT
>probe:Drosophila_2:1630457_s_at:36:227; Interrogation_Position=818; Antisense; AAGGAATCTCGTACCACTGTGCTGG
>probe:Drosophila_2:1630457_s_at:428:143; Interrogation_Position=833; Antisense; ACTGTGCTGGGTGGCGAATTGAAAC
>probe:Drosophila_2:1630457_s_at:656:141; Interrogation_Position=856; Antisense; ACTGATCACCGAAAGTTGACTGTTT
>probe:Drosophila_2:1630457_s_at:544:591; Interrogation_Position=911; Antisense; TGGGCGAGTTGTGTGTTTTTATATA
>probe:Drosophila_2:1630457_s_at:454:19; Interrogation_Position=931; Antisense; ATATAGGGTGCGCTTGTCAGACAAA

Paste this into a BLAST search page for me
GGAGCCCAGTGCTGCAAGATGTACTGATGTACTAACTAATCACTTTACGACTTTACGAAATTGTGTCTTGCGATAGCGATATAATGAGCTTAACTGCGAAATGATGTCAGCCGTAGTTTATTTAGGTTTATTTAGACACGCACACACTCAGCACACACTCAGAAGTCGGCGATATTACACATGGGTACTATCAACTTGAAGGAAACGCCACTGATTCATATTTGTAAGGAATCTCGTACCACTGTGCTGGACTGTGCTGGGTGGCGAATTGAAACACTGATCACCGAAAGTTGACTGTTTTGGGCGAGTTGTGTGTTTTTATATAATATAGGGTGCGCTTGTCAGACAAA

Full Affymetrix probeset data:

Annotations for 1630457_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime