FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630458_at:

>probe:Drosophila_2:1630458_at:14:365; Interrogation_Position=112; Antisense; GAATTCAAACTCAATATGGCCGATG
>probe:Drosophila_2:1630458_at:356:69; Interrogation_Position=127; Antisense; ATGGCCGATGAGCAGAAGATTGTTC
>probe:Drosophila_2:1630458_at:390:465; Interrogation_Position=144; Antisense; GATTGTTCTCATGGTTTATGTCTAC
>probe:Drosophila_2:1630458_at:345:175; Interrogation_Position=213; Antisense; AAAGCCGTTCTGTCAGTTCATTAAA
>probe:Drosophila_2:1630458_at:212:445; Interrogation_Position=241; Antisense; GATGAGGACTCGTATCCAAGCATAC
>probe:Drosophila_2:1630458_at:216:169; Interrogation_Position=267; Antisense; AAAGGCTTCCAATTTACCGGATCAG
>probe:Drosophila_2:1630458_at:117:131; Interrogation_Position=282; Antisense; ACCGGATCAGGATACATGCCCATTT
>probe:Drosophila_2:1630458_at:282:585; Interrogation_Position=341; Antisense; TGGAGACCAATTTCCTACCGGACAA
>probe:Drosophila_2:1630458_at:433:231; Interrogation_Position=364; Antisense; AATGCACCCAAAGGCGACTATCTGT
>probe:Drosophila_2:1630458_at:372:39; Interrogation_Position=383; Antisense; ATCTGTTGCAGTTATCCTTGTTGGA
>probe:Drosophila_2:1630458_at:55:49; Interrogation_Position=396; Antisense; ATCCTTGTTGGATCGTGAGGTCCCA
>probe:Drosophila_2:1630458_at:156:513; Interrogation_Position=410; Antisense; GTGAGGTCCCAGTAGCAGGACTTGT
>probe:Drosophila_2:1630458_at:611:595; Interrogation_Position=432; Antisense; TGTGGCTACTGTTACCCTGACTTAA
>probe:Drosophila_2:1630458_at:119:33; Interrogation_Position=86; Antisense; ATCAATTTGTGGTTAGCGGAGACTT

Paste this into a BLAST search page for me
GAATTCAAACTCAATATGGCCGATGATGGCCGATGAGCAGAAGATTGTTCGATTGTTCTCATGGTTTATGTCTACAAAGCCGTTCTGTCAGTTCATTAAAGATGAGGACTCGTATCCAAGCATACAAAGGCTTCCAATTTACCGGATCAGACCGGATCAGGATACATGCCCATTTTGGAGACCAATTTCCTACCGGACAAAATGCACCCAAAGGCGACTATCTGTATCTGTTGCAGTTATCCTTGTTGGAATCCTTGTTGGATCGTGAGGTCCCAGTGAGGTCCCAGTAGCAGGACTTGTTGTGGCTACTGTTACCCTGACTTAAATCAATTTGTGGTTAGCGGAGACTT

Full Affymetrix probeset data:

Annotations for 1630458_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720