FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630460_at:

>probe:Drosophila_2:1630460_at:153:335; Interrogation_Position=349; Antisense; GCTGCTTATGCGCAAGACGGCTAAC
>probe:Drosophila_2:1630460_at:503:407; Interrogation_Position=364; Antisense; GACGGCTAACGTGACCTATGGCGAT
>probe:Drosophila_2:1630460_at:142:457; Interrogation_Position=386; Antisense; GATACATGTATCACACTTGGCTGGG
>probe:Drosophila_2:1630460_at:93:635; Interrogation_Position=432; Antisense; TCGCTCTGTCAGAAGCACTACGACA
>probe:Drosophila_2:1630460_at:249:713; Interrogation_Position=459; Antisense; TTCACCGCGGACCACAATGTGTGCA
>probe:Drosophila_2:1630460_at:24:381; Interrogation_Position=486; Antisense; GAACCCGTGGGAGAAAGCATGAACT
>probe:Drosophila_2:1630460_at:541:603; Interrogation_Position=553; Antisense; TGTTCGGGCTCATTGGCGGACACAT
>probe:Drosophila_2:1630460_at:67:575; Interrogation_Position=588; Antisense; GGCGGCAAGGCCATGAAGTTCCTCA
>probe:Drosophila_2:1630460_at:141:95; Interrogation_Position=604; Antisense; AGTTCCTCAGCTTTCTGTACTACAA
>probe:Drosophila_2:1630460_at:88:161; Interrogation_Position=625; Antisense; ACAAGGACTGGATTCTTCTCACCAT
>probe:Drosophila_2:1630460_at:636:517; Interrogation_Position=670; Antisense; GGGTCAGAGTATCCTTAAGTCGTGT
>probe:Drosophila_2:1630460_at:151:637; Interrogation_Position=689; Antisense; TCGTGTTTTTCTTACTCCCTTGCTA
>probe:Drosophila_2:1630460_at:68:633; Interrogation_Position=704; Antisense; TCCCTTGCTACTGATTCTCGTAAAT
>probe:Drosophila_2:1630460_at:95:509; Interrogation_Position=767; Antisense; GTGCGGCATCACATTGAGTTCAGAT

Paste this into a BLAST search page for me
GCTGCTTATGCGCAAGACGGCTAACGACGGCTAACGTGACCTATGGCGATGATACATGTATCACACTTGGCTGGGTCGCTCTGTCAGAAGCACTACGACATTCACCGCGGACCACAATGTGTGCAGAACCCGTGGGAGAAAGCATGAACTTGTTCGGGCTCATTGGCGGACACATGGCGGCAAGGCCATGAAGTTCCTCAAGTTCCTCAGCTTTCTGTACTACAAACAAGGACTGGATTCTTCTCACCATGGGTCAGAGTATCCTTAAGTCGTGTTCGTGTTTTTCTTACTCCCTTGCTATCCCTTGCTACTGATTCTCGTAAATGTGCGGCATCACATTGAGTTCAGAT

Full Affymetrix probeset data:

Annotations for 1630460_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720