FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630462_at:

>probe:Drosophila_2:1630462_at:665:47; Interrogation_Position=101; Antisense; ATCCTGATTGCATTTATCGCGAGAC
>probe:Drosophila_2:1630462_at:486:45; Interrogation_Position=116; Antisense; ATCGCGAGACGGGTGCCATGGTCAA
>probe:Drosophila_2:1630462_at:424:213; Interrogation_Position=179; Antisense; AAGAGCACGTTCATCGGCGGGATCA
>probe:Drosophila_2:1630462_at:259:559; Interrogation_Position=204; Antisense; GGAAATTGTTTCTCACATAGTGCAA
>probe:Drosophila_2:1630462_at:388:25; Interrogation_Position=220; Antisense; ATAGTGCAATCCTTCGAATCCTGTC
>probe:Drosophila_2:1630462_at:629:365; Interrogation_Position=235; Antisense; GAATCCTGTCTGTCGAACGTTAAAG
>probe:Drosophila_2:1630462_at:616:431; Interrogation_Position=283; Antisense; GAGTCGTACAAAGTGCTGCCCCATG
>probe:Drosophila_2:1630462_at:632:29; Interrogation_Position=333; Antisense; ATACAGCTGTGTGAATGCCGAGACT
>probe:Drosophila_2:1630462_at:303:49; Interrogation_Position=347; Antisense; ATGCCGAGACTTTTCTCAATTGCCC
>probe:Drosophila_2:1630462_at:307:391; Interrogation_Position=393; Antisense; GAAACCCTGTAATTTGGCCAAGCAA
>probe:Drosophila_2:1630462_at:232:209; Interrogation_Position=412; Antisense; AAGCAATTCGCCGAGCAGTGCAATC
>probe:Drosophila_2:1630462_at:100:663; Interrogation_Position=56; Antisense; TAAAGTCGGCGAACTCCAAGTATCC
>probe:Drosophila_2:1630462_at:104:217; Interrogation_Position=73; Antisense; AAGTATCCCAGCTATGCTCATCTGT
>probe:Drosophila_2:1630462_at:188:53; Interrogation_Position=86; Antisense; ATGCTCATCTGTGCTATCCTGATTG

Paste this into a BLAST search page for me
ATCCTGATTGCATTTATCGCGAGACATCGCGAGACGGGTGCCATGGTCAAAAGAGCACGTTCATCGGCGGGATCAGGAAATTGTTTCTCACATAGTGCAAATAGTGCAATCCTTCGAATCCTGTCGAATCCTGTCTGTCGAACGTTAAAGGAGTCGTACAAAGTGCTGCCCCATGATACAGCTGTGTGAATGCCGAGACTATGCCGAGACTTTTCTCAATTGCCCGAAACCCTGTAATTTGGCCAAGCAAAAGCAATTCGCCGAGCAGTGCAATCTAAAGTCGGCGAACTCCAAGTATCCAAGTATCCCAGCTATGCTCATCTGTATGCTCATCTGTGCTATCCTGATTG

Full Affymetrix probeset data:

Annotations for 1630462_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720