FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630464_at:

>probe:Drosophila_2:1630464_at:352:243; Interrogation_Position=1007; Antisense; AATTTTCGGCTCTCGGCAAAGCTAT
>probe:Drosophila_2:1630464_at:447:173; Interrogation_Position=1024; Antisense; AAAGCTATTTTCGTGCTCCTTCTGG
>probe:Drosophila_2:1630464_at:376:635; Interrogation_Position=1056; Antisense; TCGCGCCGGGCTGGAATGTCGAATA
>probe:Drosophila_2:1630464_at:404:555; Interrogation_Position=1144; Antisense; GGACGGCAACGCCTATTGAATGGAA
>probe:Drosophila_2:1630464_at:401:559; Interrogation_Position=1165; Antisense; GGAACACTTAACTTTCACGTCGATT
>probe:Drosophila_2:1630464_at:160:495; Interrogation_Position=1209; Antisense; GTCAAACGAGGTCCTTGCACTCAAA
>probe:Drosophila_2:1630464_at:19:493; Interrogation_Position=1258; Antisense; GTAAGCGCGCGTTTCAAAACCTGCA
>probe:Drosophila_2:1630464_at:535:89; Interrogation_Position=1307; Antisense; AGTACTTTGCGGTCTCATTCAAGGA
>probe:Drosophila_2:1630464_at:615:537; Interrogation_Position=1348; Antisense; GGTACTGAAGCCTGTCCAATCAAGA
>probe:Drosophila_2:1630464_at:305:177; Interrogation_Position=1392; Antisense; AAACGTGGAGGTGATCGCCGACAAT
>probe:Drosophila_2:1630464_at:552:309; Interrogation_Position=1429; Antisense; GCCAAACTGGGCCTAGTACGATCGA
>probe:Drosophila_2:1630464_at:76:697; Interrogation_Position=934; Antisense; TTTCGCTCATTGCAGGCGCAACTGT
>probe:Drosophila_2:1630464_at:564:575; Interrogation_Position=948; Antisense; GGCGCAACTGTTTGGATATTCTCGA
>probe:Drosophila_2:1630464_at:506:697; Interrogation_Position=980; Antisense; TTTCAATTTCAGTCCAGTTTGGGTG

Paste this into a BLAST search page for me
AATTTTCGGCTCTCGGCAAAGCTATAAAGCTATTTTCGTGCTCCTTCTGGTCGCGCCGGGCTGGAATGTCGAATAGGACGGCAACGCCTATTGAATGGAAGGAACACTTAACTTTCACGTCGATTGTCAAACGAGGTCCTTGCACTCAAAGTAAGCGCGCGTTTCAAAACCTGCAAGTACTTTGCGGTCTCATTCAAGGAGGTACTGAAGCCTGTCCAATCAAGAAAACGTGGAGGTGATCGCCGACAATGCCAAACTGGGCCTAGTACGATCGATTTCGCTCATTGCAGGCGCAACTGTGGCGCAACTGTTTGGATATTCTCGATTTCAATTTCAGTCCAGTTTGGGTG

Full Affymetrix probeset data:

Annotations for 1630464_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720