FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630466_at:

>probe:Drosophila_2:1630466_at:525:43; Interrogation_Position=5882; Antisense; ATCCGTCCCGAGTTCGAAGTCGAAG
>probe:Drosophila_2:1630466_at:710:271; Interrogation_Position=5954; Antisense; CATCATGTGTTCTTGTACTGCAGCG
>probe:Drosophila_2:1630466_at:398:487; Interrogation_Position=5968; Antisense; GTACTGCAGCGAGGACTTCATTAAT
>probe:Drosophila_2:1630466_at:88:55; Interrogation_Position=5991; Antisense; ATGACCACCGCTTCAACGTGTTAAT
>probe:Drosophila_2:1630466_at:721:139; Interrogation_Position=6006; Antisense; ACGTGTTAATGCCACCGCTGGTCAA
>probe:Drosophila_2:1630466_at:123:473; Interrogation_Position=6077; Antisense; GTTCTCAGTAACTGCATTGCCCAGT
>probe:Drosophila_2:1630466_at:185:331; Interrogation_Position=6104; Antisense; GCGGTGGCCACCAACGATGTGATGT
>probe:Drosophila_2:1630466_at:11:87; Interrogation_Position=6181; Antisense; AGTGCGGATTCTGGCATTCAACAGT
>probe:Drosophila_2:1630466_at:171:653; Interrogation_Position=6198; Antisense; TCAACAGTTGTGTGGCTATCGCGCG
>probe:Drosophila_2:1630466_at:158:341; Interrogation_Position=6212; Antisense; GCTATCGCGCGCAAACTGGGTGAAA
>probe:Drosophila_2:1630466_at:120:593; Interrogation_Position=6228; Antisense; TGGGTGAAAGCTATGCCGCCCTGTT
>probe:Drosophila_2:1630466_at:434:469; Interrogation_Position=6250; Antisense; GTTGCCAGAGACAGTTCCATTCATC
>probe:Drosophila_2:1630466_at:272:13; Interrogation_Position=6268; Antisense; ATTCATCGCTGAGCTCCTGGAGGAC
>probe:Drosophila_2:1630466_at:11:149; Interrogation_Position=6344; Antisense; ACTATTTTAGGCGAGTCTGTGCAAA

Paste this into a BLAST search page for me
ATCCGTCCCGAGTTCGAAGTCGAAGCATCATGTGTTCTTGTACTGCAGCGGTACTGCAGCGAGGACTTCATTAATATGACCACCGCTTCAACGTGTTAATACGTGTTAATGCCACCGCTGGTCAAGTTCTCAGTAACTGCATTGCCCAGTGCGGTGGCCACCAACGATGTGATGTAGTGCGGATTCTGGCATTCAACAGTTCAACAGTTGTGTGGCTATCGCGCGGCTATCGCGCGCAAACTGGGTGAAATGGGTGAAAGCTATGCCGCCCTGTTGTTGCCAGAGACAGTTCCATTCATCATTCATCGCTGAGCTCCTGGAGGACACTATTTTAGGCGAGTCTGTGCAAA

Full Affymetrix probeset data:

Annotations for 1630466_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720