Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630467_a_at:

>probe:Drosophila_2:1630467_a_at:687:637; Interrogation_Position=410; Antisense; TCGGGTACCCAGGAGGCGAAACATC
>probe:Drosophila_2:1630467_a_at:547:389; Interrogation_Position=427; Antisense; GAAACATCGCATGGGTCTGGCTGCA
>probe:Drosophila_2:1630467_a_at:317:617; Interrogation_Position=448; Antisense; TGCAGCCAACTTTGCCGGAGGACCC
>probe:Drosophila_2:1630467_a_at:202:71; Interrogation_Position=479; Antisense; AGGCGACGATCCGAGACCGATGTCT
>probe:Drosophila_2:1630467_a_at:204:413; Interrogation_Position=493; Antisense; GACCGATGTCTAAGGCGTCTGGATG
>probe:Drosophila_2:1630467_a_at:392:103; Interrogation_Position=518; Antisense; AGACCGGGCTGCGAATCCTGTGAAC
>probe:Drosophila_2:1630467_a_at:2:693; Interrogation_Position=564; Antisense; TTTCCACCTAAACTTGGCCCATACT
>probe:Drosophila_2:1630467_a_at:194:581; Interrogation_Position=578; Antisense; TGGCCCATACTTTGATACTTTCCTA
>probe:Drosophila_2:1630467_a_at:314:667; Interrogation_Position=593; Antisense; TACTTTCCTAGATCTTTCATTTGCA
>probe:Drosophila_2:1630467_a_at:91:561; Interrogation_Position=663; Antisense; GGAAATGTCCTCATGCAATTCATCA
>probe:Drosophila_2:1630467_a_at:3:199; Interrogation_Position=766; Antisense; AAGCGTTAAACTGTTGCTCCGAAAG
>probe:Drosophila_2:1630467_a_at:561:711; Interrogation_Position=821; Antisense; TTCATCCCAGATTTAACTCAGTGCT
>probe:Drosophila_2:1630467_a_at:155:7; Interrogation_Position=840; Antisense; AGTGCTAATTGCTCGTTTTAACCCG
>probe:Drosophila_2:1630467_a_at:515:11; Interrogation_Position=927; Antisense; ATTCAAGTGTAAGCATAATCGCGCA

Paste this into a BLAST search page for me
TCGGGTACCCAGGAGGCGAAACATCGAAACATCGCATGGGTCTGGCTGCATGCAGCCAACTTTGCCGGAGGACCCAGGCGACGATCCGAGACCGATGTCTGACCGATGTCTAAGGCGTCTGGATGAGACCGGGCTGCGAATCCTGTGAACTTTCCACCTAAACTTGGCCCATACTTGGCCCATACTTTGATACTTTCCTATACTTTCCTAGATCTTTCATTTGCAGGAAATGTCCTCATGCAATTCATCAAAGCGTTAAACTGTTGCTCCGAAAGTTCATCCCAGATTTAACTCAGTGCTAGTGCTAATTGCTCGTTTTAACCCGATTCAAGTGTAAGCATAATCGCGCA

Full Affymetrix probeset data:

Annotations for 1630467_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime