FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630468_at:

>probe:Drosophila_2:1630468_at:567:571; Interrogation_Position=1008; Antisense; GGCTCAGGAGCTCATCACCGTGGAT
>probe:Drosophila_2:1630468_at:431:131; Interrogation_Position=1024; Antisense; ACCGTGGATCCCGATAATTGTGTAT
>probe:Drosophila_2:1630468_at:66:729; Interrogation_Position=1041; Antisense; TTGTGTATATCGAGCAGCGCCGGGC
>probe:Drosophila_2:1630468_at:592:289; Interrogation_Position=502; Antisense; CGTGCAGTTCGCTTCCAGGAAACGG
>probe:Drosophila_2:1630468_at:61:565; Interrogation_Position=569; Antisense; TGAATTCGTCGAGCTCGGGACCCAG
>probe:Drosophila_2:1630468_at:104:553; Interrogation_Position=586; Antisense; GGACCCAGGGAGAAGCGACGCTACC
>probe:Drosophila_2:1630468_at:127:417; Interrogation_Position=636; Antisense; GAGATTCAGTCTCTCGAAGGGCCGC
>probe:Drosophila_2:1630468_at:683:473; Interrogation_Position=710; Antisense; GTTACTACCTGCGAACCAGCAAGGC
>probe:Drosophila_2:1630468_at:450:111; Interrogation_Position=727; Antisense; AGCAAGGCGGGAACTCTGGTGATAC
>probe:Drosophila_2:1630468_at:295:551; Interrogation_Position=756; Antisense; GGAGAGCTTCAGTTCCCAGAAGATG
>probe:Drosophila_2:1630468_at:423:375; Interrogation_Position=774; Antisense; GAAGATGAGACATCGTCGCCGTCGT
>probe:Drosophila_2:1630468_at:476:145; Interrogation_Position=809; Antisense; ACTCCTCCAGCGAGAATATCCTGCA
>probe:Drosophila_2:1630468_at:51:111; Interrogation_Position=842; Antisense; AGAAGGAACCGCCAGCCACCAGTGT
>probe:Drosophila_2:1630468_at:528:71; Interrogation_Position=896; Antisense; AGGAAAGGACACTCTCCACGTCGGA

Paste this into a BLAST search page for me
GGCTCAGGAGCTCATCACCGTGGATACCGTGGATCCCGATAATTGTGTATTTGTGTATATCGAGCAGCGCCGGGCCGTGCAGTTCGCTTCCAGGAAACGGTGAATTCGTCGAGCTCGGGACCCAGGGACCCAGGGAGAAGCGACGCTACCGAGATTCAGTCTCTCGAAGGGCCGCGTTACTACCTGCGAACCAGCAAGGCAGCAAGGCGGGAACTCTGGTGATACGGAGAGCTTCAGTTCCCAGAAGATGGAAGATGAGACATCGTCGCCGTCGTACTCCTCCAGCGAGAATATCCTGCAAGAAGGAACCGCCAGCCACCAGTGTAGGAAAGGACACTCTCCACGTCGGA

Full Affymetrix probeset data:

Annotations for 1630468_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720