Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630471_at:

>probe:Drosophila_2:1630471_at:224:143; Interrogation_Position=3545; Antisense; ACTGGCCGTACTTCCTGATGTGGGT
>probe:Drosophila_2:1630471_at:181:441; Interrogation_Position=3561; Antisense; GATGTGGGTCCTATTTGCGATCTAC
>probe:Drosophila_2:1630471_at:582:19; Interrogation_Position=3573; Antisense; ATTTGCGATCTACCACAGTGTCATC
>probe:Drosophila_2:1630471_at:519:515; Interrogation_Position=3590; Antisense; GTGTCATCATATTCTACTTCGCCTT
>probe:Drosophila_2:1630471_at:323:699; Interrogation_Position=3622; Antisense; TTCTACTACAACAACGTTCTCCTGA
>probe:Drosophila_2:1630471_at:419:591; Interrogation_Position=3707; Antisense; TGGTCGTGAACCTTAAGCTCTGGCT
>probe:Drosophila_2:1630471_at:524:571; Interrogation_Position=3728; Antisense; GGCTCGAGTCAATGTATCTGTCCTT
>probe:Drosophila_2:1630471_at:187:33; Interrogation_Position=3820; Antisense; ATCAATCTGGACTACGACACCGACA
>probe:Drosophila_2:1630471_at:493:643; Interrogation_Position=3845; Antisense; TCTACTGGGCCTACAACAATCTGTT
>probe:Drosophila_2:1630471_at:466:283; Interrogation_Position=3877; Antisense; CTGCCAGTCTGGCTGTGGATCATAG
>probe:Drosophila_2:1630471_at:547:453; Interrogation_Position=3894; Antisense; GATCATAGTGACCTGTGTGGCCTGC
>probe:Drosophila_2:1630471_at:499:687; Interrogation_Position=3931; Antisense; TATACCATCCGAATGCTCCAGAGGG
>probe:Drosophila_2:1630471_at:424:581; Interrogation_Position=3965; Antisense; TAAAGAGTTTCAGCATTTTTCCCGG
>probe:Drosophila_2:1630471_at:391:431; Interrogation_Position=4024; Antisense; GAGTCCACATACTTGTAATCGTCGA

Paste this into a BLAST search page for me
ACTGGCCGTACTTCCTGATGTGGGTGATGTGGGTCCTATTTGCGATCTACATTTGCGATCTACCACAGTGTCATCGTGTCATCATATTCTACTTCGCCTTTTCTACTACAACAACGTTCTCCTGATGGTCGTGAACCTTAAGCTCTGGCTGGCTCGAGTCAATGTATCTGTCCTTATCAATCTGGACTACGACACCGACATCTACTGGGCCTACAACAATCTGTTCTGCCAGTCTGGCTGTGGATCATAGGATCATAGTGACCTGTGTGGCCTGCTATACCATCCGAATGCTCCAGAGGGTAAAGAGTTTCAGCATTTTTCCCGGGAGTCCACATACTTGTAATCGTCGA

Full Affymetrix probeset data:

Annotations for 1630471_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime