FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630473_at:

>probe:Drosophila_2:1630473_at:532:713; Interrogation_Position=480; Antisense; TTCGATGAGCCCCAGCAGCTGGAGC
>probe:Drosophila_2:1630473_at:611:113; Interrogation_Position=493; Antisense; AGCAGCTGGAGCGTGTGTCCTCTGC
>probe:Drosophila_2:1630473_at:611:291; Interrogation_Position=504; Antisense; CGTGTGTCCTCTGCCCTGAACAAGG
>probe:Drosophila_2:1630473_at:129:387; Interrogation_Position=521; Antisense; GAACAAGGCCCTGCGCGTTGTCTTC
>probe:Drosophila_2:1630473_at:604:77; Interrogation_Position=791; Antisense; AGGATCCAGCCAGGCCCACAACGGT
>probe:Drosophila_2:1630473_at:11:33; Interrogation_Position=899; Antisense; ATCTTCGGTCTTCCGTCGCGTCTAA
>probe:Drosophila_2:1630473_at:72:503; Interrogation_Position=913; Antisense; GTCGCGTCTAAGTCGCTCGTTTCAC
>probe:Drosophila_2:1630473_at:540:641; Interrogation_Position=919; Antisense; TCTAAGTCGCTCGTTTCACTCCTTT
>probe:Drosophila_2:1630473_at:676:637; Interrogation_Position=929; Antisense; TCGTTTCACTCCTTTCGGAATCGAA
>probe:Drosophila_2:1630473_at:545:689; Interrogation_Position=941; Antisense; TTTCGGAATCGAAAACGCCAGCGAT
>probe:Drosophila_2:1630473_at:515:181; Interrogation_Position=952; Antisense; AAAACGCCAGCGATTTTTGACTGAT
>probe:Drosophila_2:1630473_at:446:313; Interrogation_Position=957; Antisense; GCCAGCGATTTTTGACTGATATTAA
>probe:Drosophila_2:1630473_at:343:237; Interrogation_Position=981; Antisense; AATCGTAGTTTTTGTTGACTAATGC
>probe:Drosophila_2:1630473_at:116:477; Interrogation_Position=988; Antisense; GTTTTTGTTGACTAATGCTTAAATA

Paste this into a BLAST search page for me
TTCGATGAGCCCCAGCAGCTGGAGCAGCAGCTGGAGCGTGTGTCCTCTGCCGTGTGTCCTCTGCCCTGAACAAGGGAACAAGGCCCTGCGCGTTGTCTTCAGGATCCAGCCAGGCCCACAACGGTATCTTCGGTCTTCCGTCGCGTCTAAGTCGCGTCTAAGTCGCTCGTTTCACTCTAAGTCGCTCGTTTCACTCCTTTTCGTTTCACTCCTTTCGGAATCGAATTTCGGAATCGAAAACGCCAGCGATAAAACGCCAGCGATTTTTGACTGATGCCAGCGATTTTTGACTGATATTAAAATCGTAGTTTTTGTTGACTAATGCGTTTTTGTTGACTAATGCTTAAATA

Full Affymetrix probeset data:

Annotations for 1630473_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720