FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630474_at:

>probe:Drosophila_2:1630474_at:314:455; Interrogation_Position=129; Antisense; GATACTATCGCGACTGCAGGACATG
>probe:Drosophila_2:1630474_at:9:67; Interrogation_Position=13; Antisense; ATGGATGCTCGACTTTTCGCACAAC
>probe:Drosophila_2:1630474_at:619:159; Interrogation_Position=191; Antisense; ACAAAATTGATTTGGCCCGCTCACG
>probe:Drosophila_2:1630474_at:313:167; Interrogation_Position=238; Antisense; AAATGCGTGGCCTGCACGTTTGGAG
>probe:Drosophila_2:1630474_at:467:217; Interrogation_Position=265; Antisense; AAGTTTATCGAGGTCTCCGTGGGCA
>probe:Drosophila_2:1630474_at:425:517; Interrogation_Position=283; Antisense; GTGGGCATCAATCACAACTGCGACG
>probe:Drosophila_2:1630474_at:127:415; Interrogation_Position=349; Antisense; GACCAAGTTCAGTTGCAGGGACCAA
>probe:Drosophila_2:1630474_at:456:129; Interrogation_Position=36; Antisense; ACGCCTGCACTTGACGGATGAACTG
>probe:Drosophila_2:1630474_at:579:245; Interrogation_Position=382; Antisense; AATTCGCCGGCGCATTGGTACAAAA
>probe:Drosophila_2:1630474_at:496:183; Interrogation_Position=403; Antisense; AAAAGCCGCAGCGTGATGCTGGCCA
>probe:Drosophila_2:1630474_at:309:99; Interrogation_Position=443; Antisense; AGATGCTCACCTGGATCCTGGGCAA
>probe:Drosophila_2:1630474_at:48:75; Interrogation_Position=470; Antisense; AGGACTCCAAGTTCAAGCACTGCGA
>probe:Drosophila_2:1630474_at:497:71; Interrogation_Position=65; Antisense; AGGCGGATGCCTTTCTGGTGGTCTA
>probe:Drosophila_2:1630474_at:335:519; Interrogation_Position=82; Antisense; GTGGTCTACTCCTGCATTGACAAGG

Paste this into a BLAST search page for me
GATACTATCGCGACTGCAGGACATGATGGATGCTCGACTTTTCGCACAACACAAAATTGATTTGGCCCGCTCACGAAATGCGTGGCCTGCACGTTTGGAGAAGTTTATCGAGGTCTCCGTGGGCAGTGGGCATCAATCACAACTGCGACGGACCAAGTTCAGTTGCAGGGACCAAACGCCTGCACTTGACGGATGAACTGAATTCGCCGGCGCATTGGTACAAAAAAAAGCCGCAGCGTGATGCTGGCCAAGATGCTCACCTGGATCCTGGGCAAAGGACTCCAAGTTCAAGCACTGCGAAGGCGGATGCCTTTCTGGTGGTCTAGTGGTCTACTCCTGCATTGACAAGG

Full Affymetrix probeset data:

Annotations for 1630474_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720