Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630480_at:

>probe:Drosophila_2:1630480_at:54:427; Interrogation_Position=364; Antisense; GAGATGAATATGGTAGGTGATCCAA
>probe:Drosophila_2:1630480_at:269:677; Interrogation_Position=377; Antisense; TAGGTGATCCAAGAGATTCCTTTCA
>probe:Drosophila_2:1630480_at:601:533; Interrogation_Position=379; Antisense; GGTGATCCAAGAGATTCCTTTCAAA
>probe:Drosophila_2:1630480_at:585:47; Interrogation_Position=383; Antisense; ATCCAAGAGATTCCTTTCAAAGTCG
>probe:Drosophila_2:1630480_at:662:463; Interrogation_Position=391; Antisense; GATTCCTTTCAAAGTCGAAATCCTT
>probe:Drosophila_2:1630480_at:154:161; Interrogation_Position=401; Antisense; AAAGTCGAAATCCTTCAGAGAAGCA
>probe:Drosophila_2:1630480_at:60:499; Interrogation_Position=404; Antisense; GTCGAAATCCTTCAGAGAAGCAGGA
>probe:Drosophila_2:1630480_at:575:421; Interrogation_Position=418; Antisense; GAGAAGCAGGAGCTTATTCCTTTCA
>probe:Drosophila_2:1630480_at:314:349; Interrogation_Position=423; Antisense; GCAGGAGCTTATTCCTTTCAATTCT
>probe:Drosophila_2:1630480_at:675:417; Interrogation_Position=427; Antisense; GAGCTTATTCCTTTCAATTCTCACC
>probe:Drosophila_2:1630480_at:658:703; Interrogation_Position=431; Antisense; TTATTCCTTTCAATTCTCACCCACA
>probe:Drosophila_2:1630480_at:407:695; Interrogation_Position=438; Antisense; TTTCAATTCTCACCCACAGGTGGAT
>probe:Drosophila_2:1630480_at:94:247; Interrogation_Position=442; Antisense; AATTCTCACCCACAGGTGGATGGCA
>probe:Drosophila_2:1630480_at:95:641; Interrogation_Position=445; Antisense; TCTCACCCACAGGTGGATGGCAATG

Paste this into a BLAST search page for me
GAGATGAATATGGTAGGTGATCCAATAGGTGATCCAAGAGATTCCTTTCAGGTGATCCAAGAGATTCCTTTCAAAATCCAAGAGATTCCTTTCAAAGTCGGATTCCTTTCAAAGTCGAAATCCTTAAAGTCGAAATCCTTCAGAGAAGCAGTCGAAATCCTTCAGAGAAGCAGGAGAGAAGCAGGAGCTTATTCCTTTCAGCAGGAGCTTATTCCTTTCAATTCTGAGCTTATTCCTTTCAATTCTCACCTTATTCCTTTCAATTCTCACCCACATTTCAATTCTCACCCACAGGTGGATAATTCTCACCCACAGGTGGATGGCATCTCACCCACAGGTGGATGGCAATG

Full Affymetrix probeset data:

Annotations for 1630480_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime