FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630481_at:

>probe:Drosophila_2:1630481_at:454:453; Interrogation_Position=298; Antisense; GATATTATTGTGTGCCCAGTTCGAG
>probe:Drosophila_2:1630481_at:231:391; Interrogation_Position=326; Antisense; GAAACTACTCGCTTCTAAATTCCGA
>probe:Drosophila_2:1630481_at:495:57; Interrogation_Position=378; Antisense; AGTCCAGAATGGCACCTACAGGTTC
>probe:Drosophila_2:1630481_at:637:127; Interrogation_Position=391; Antisense; ACCTACAGGTTCTTCGCCGAAATTG
>probe:Drosophila_2:1630481_at:588:393; Interrogation_Position=438; Antisense; GAAAGTGTTCGCACTCCAAGTCACT
>probe:Drosophila_2:1630481_at:518:135; Interrogation_Position=521; Antisense; ACGAATTTCGTAACGCTGCTCCAAA
>probe:Drosophila_2:1630481_at:715:451; Interrogation_Position=551; Antisense; GATCTGGATCTGTGTGGCTTCTTCA
>probe:Drosophila_2:1630481_at:357:521; Interrogation_Position=564; Antisense; GTGGCTTCTTCACGGAGTTCAGAAA
>probe:Drosophila_2:1630481_at:64:151; Interrogation_Position=636; Antisense; ACATTATTGTCTGTCCAGTGCGTGT
>probe:Drosophila_2:1630481_at:375:507; Interrogation_Position=653; Antisense; GTGCGTGTGGGAAACTACTCAGTGA
>probe:Drosophila_2:1630481_at:725:401; Interrogation_Position=695; Antisense; GACATCTATCCTCAGGTTCTACAGA
>probe:Drosophila_2:1630481_at:390:389; Interrogation_Position=764; Antisense; GAAAAAGTCTTTGCCCTGCAGGTTA
>probe:Drosophila_2:1630481_at:523:615; Interrogation_Position=780; Antisense; TGCAGGTTACCACCGAGGTCCGAAT
>probe:Drosophila_2:1630481_at:625:503; Interrogation_Position=797; Antisense; GTCCGAATACCAACTGCCGCAGAAT

Paste this into a BLAST search page for me
GATATTATTGTGTGCCCAGTTCGAGGAAACTACTCGCTTCTAAATTCCGAAGTCCAGAATGGCACCTACAGGTTCACCTACAGGTTCTTCGCCGAAATTGGAAAGTGTTCGCACTCCAAGTCACTACGAATTTCGTAACGCTGCTCCAAAGATCTGGATCTGTGTGGCTTCTTCAGTGGCTTCTTCACGGAGTTCAGAAAACATTATTGTCTGTCCAGTGCGTGTGTGCGTGTGGGAAACTACTCAGTGAGACATCTATCCTCAGGTTCTACAGAGAAAAAGTCTTTGCCCTGCAGGTTATGCAGGTTACCACCGAGGTCCGAATGTCCGAATACCAACTGCCGCAGAAT

Full Affymetrix probeset data:

Annotations for 1630481_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720