FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630482_at:

>probe:Drosophila_2:1630482_at:721:21; Interrogation_Position=1313; Antisense; ATATATGTGCTTTGCGGACTGTCAA
>probe:Drosophila_2:1630482_at:1:543; Interrogation_Position=1366; Antisense; GGATTGGCTGATTCGCTCTTAAAGA
>probe:Drosophila_2:1630482_at:544:443; Interrogation_Position=1404; Antisense; GATGATCTCGGGTAACTATGGCGTT
>probe:Drosophila_2:1630482_at:183:69; Interrogation_Position=1421; Antisense; ATGGCGTTATCCAGTACACCGATTC
>probe:Drosophila_2:1630482_at:162:463; Interrogation_Position=1441; Antisense; GATTCACTGAAATGTTCCTGCGCCT
>probe:Drosophila_2:1630482_at:500:313; Interrogation_Position=1462; Antisense; GCCTTACCAGGCGTAGACAGCAGTG
>probe:Drosophila_2:1630482_at:91:181; Interrogation_Position=1490; Antisense; AAAACACCCGTATGCCTGGTATGGT
>probe:Drosophila_2:1630482_at:162:161; Interrogation_Position=1584; Antisense; AAATCGAATGGCCTCGTTACACCCA
>probe:Drosophila_2:1630482_at:83:475; Interrogation_Position=1599; Antisense; GTTACACCCACTCGGAATCAGGTTG
>probe:Drosophila_2:1630482_at:655:359; Interrogation_Position=1627; Antisense; GCAAGTGCTTCTCTCTCTCAAAAAA
>probe:Drosophila_2:1630482_at:497:245; Interrogation_Position=1709; Antisense; AATTGCCGCTTGACTAATGCTGTGG
>probe:Drosophila_2:1630482_at:649:589; Interrogation_Position=1731; Antisense; TGGTTTTTATAGATGGCGCGCACAT
>probe:Drosophila_2:1630482_at:11:503; Interrogation_Position=1768; Antisense; GTCCTGACGACTCCCAATTTGGAAA
>probe:Drosophila_2:1630482_at:620:169; Interrogation_Position=1796; Antisense; AAAGTTGCCACACCGCCAAATGTTG

Paste this into a BLAST search page for me
ATATATGTGCTTTGCGGACTGTCAAGGATTGGCTGATTCGCTCTTAAAGAGATGATCTCGGGTAACTATGGCGTTATGGCGTTATCCAGTACACCGATTCGATTCACTGAAATGTTCCTGCGCCTGCCTTACCAGGCGTAGACAGCAGTGAAAACACCCGTATGCCTGGTATGGTAAATCGAATGGCCTCGTTACACCCAGTTACACCCACTCGGAATCAGGTTGGCAAGTGCTTCTCTCTCTCAAAAAAAATTGCCGCTTGACTAATGCTGTGGTGGTTTTTATAGATGGCGCGCACATGTCCTGACGACTCCCAATTTGGAAAAAAGTTGCCACACCGCCAAATGTTG

Full Affymetrix probeset data:

Annotations for 1630482_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720