FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630485_at:

>probe:Drosophila_2:1630485_at:116:331; Interrogation_Position=158; Antisense; GCGGCTGTGTGACCTGAAATACTCC
>probe:Drosophila_2:1630485_at:103:495; Interrogation_Position=233; Antisense; GTCAATCCTGTTTGTGGTGTCCCCA
>probe:Drosophila_2:1630485_at:408:263; Interrogation_Position=256; Antisense; CAGCACATCAACTTCACTACATTTT
>probe:Drosophila_2:1630485_at:240:17; Interrogation_Position=276; Antisense; ATTTTTTCATAATGCCGGCTGCGGT
>probe:Drosophila_2:1630485_at:678:467; Interrogation_Position=299; Antisense; GTTGTAACTTCTGATGATGTCGCCA
>probe:Drosophila_2:1630485_at:250:619; Interrogation_Position=351; Antisense; TGCTCCTCGTTTTTTGTTTGCCGAA
>probe:Drosophila_2:1630485_at:376:39; Interrogation_Position=377; Antisense; ATCTCGGCGAGAAAGTGTTCCATCA
>probe:Drosophila_2:1630485_at:407:349; Interrogation_Position=420; Antisense; GCAGACCAGATCGTAGGGCCTTAAA
>probe:Drosophila_2:1630485_at:289:639; Interrogation_Position=480; Antisense; TCGTAAGCCGTTTTCTTCGGTACAG
>probe:Drosophila_2:1630485_at:415:667; Interrogation_Position=500; Antisense; TACAGTACATGCGTGGCTCGAGATC
>probe:Drosophila_2:1630485_at:577:427; Interrogation_Position=519; Antisense; GAGATCGGCATCTGGTGCGGATATT
>probe:Drosophila_2:1630485_at:270:459; Interrogation_Position=538; Antisense; GATATTGGTGATGCGGATCCCGATG
>probe:Drosophila_2:1630485_at:655:93; Interrogation_Position=606; Antisense; AGTTGCTGCATTGCCTGCCATGGGA
>probe:Drosophila_2:1630485_at:376:41; Interrogation_Position=630; Antisense; ATCGGCGGTAGCTTTTGAGACATCA

Paste this into a BLAST search page for me
GCGGCTGTGTGACCTGAAATACTCCGTCAATCCTGTTTGTGGTGTCCCCACAGCACATCAACTTCACTACATTTTATTTTTTCATAATGCCGGCTGCGGTGTTGTAACTTCTGATGATGTCGCCATGCTCCTCGTTTTTTGTTTGCCGAAATCTCGGCGAGAAAGTGTTCCATCAGCAGACCAGATCGTAGGGCCTTAAATCGTAAGCCGTTTTCTTCGGTACAGTACAGTACATGCGTGGCTCGAGATCGAGATCGGCATCTGGTGCGGATATTGATATTGGTGATGCGGATCCCGATGAGTTGCTGCATTGCCTGCCATGGGAATCGGCGGTAGCTTTTGAGACATCA

Full Affymetrix probeset data:

Annotations for 1630485_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720