Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630486_at:

>probe:Drosophila_2:1630486_at:556:329; Interrogation_Position=375; Antisense; GGTGGACTTTCTGCCGGAACGAACT
>probe:Drosophila_2:1630486_at:340:191; Interrogation_Position=396; Antisense; AACTCCCCTGTGCACGGATAACTGT
>probe:Drosophila_2:1630486_at:357:31; Interrogation_Position=413; Antisense; ATAACTGTGCGGACTTTCTGGAGGA
>probe:Drosophila_2:1630486_at:439:523; Interrogation_Position=463; Antisense; GGGCCACCACATTCAGAGATTTTCG
>probe:Drosophila_2:1630486_at:2:429; Interrogation_Position=478; Antisense; GAGATTTTCGTTCCCGATCGATCGT
>probe:Drosophila_2:1630486_at:284:83; Interrogation_Position=520; Antisense; AGTGATTCCGCCAGTCCAGCTGAAG
>probe:Drosophila_2:1630486_at:134:131; Interrogation_Position=602; Antisense; ACCTGTGCACCTTTGGCAATTGCGA
>probe:Drosophila_2:1630486_at:274:615; Interrogation_Position=653; Antisense; TGAAGGCCCATTTGAGGCGGCATCT
>probe:Drosophila_2:1630486_at:104:295; Interrogation_Position=681; Antisense; CGAGAAGCCCTACGTCTGCAGTTGG
>probe:Drosophila_2:1630486_at:273:63; Interrogation_Position=786; Antisense; ATGTGACTACTGTTCCAAGTGCTTC
>probe:Drosophila_2:1630486_at:165:455; Interrogation_Position=820; Antisense; GATCACCTCACCAAGCATCGTAAGG
>probe:Drosophila_2:1630486_at:23:511; Interrogation_Position=844; Antisense; GTGCACGAAAGACGTCTTCTGGCCG
>probe:Drosophila_2:1630486_at:100:409; Interrogation_Position=898; Antisense; GACGATCTGTATGCCGTGCGACCAG
>probe:Drosophila_2:1630486_at:90:477; Interrogation_Position=942; Antisense; GTTATGACCACATTCCAAGGACACG

Paste this into a BLAST search page for me
GGTGGACTTTCTGCCGGAACGAACTAACTCCCCTGTGCACGGATAACTGTATAACTGTGCGGACTTTCTGGAGGAGGGCCACCACATTCAGAGATTTTCGGAGATTTTCGTTCCCGATCGATCGTAGTGATTCCGCCAGTCCAGCTGAAGACCTGTGCACCTTTGGCAATTGCGATGAAGGCCCATTTGAGGCGGCATCTCGAGAAGCCCTACGTCTGCAGTTGGATGTGACTACTGTTCCAAGTGCTTCGATCACCTCACCAAGCATCGTAAGGGTGCACGAAAGACGTCTTCTGGCCGGACGATCTGTATGCCGTGCGACCAGGTTATGACCACATTCCAAGGACACG

Full Affymetrix probeset data:

Annotations for 1630486_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime