Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630487_s_at:

>probe:Drosophila_2:1630487_s_at:406:213; Interrogation_Position=130; Antisense; AAGAGCTCCAGCAGACGGGCTTCAT
>probe:Drosophila_2:1630487_s_at:501:275; Interrogation_Position=149; Antisense; CTTCATTCCAGCCAGCATCAATATA
>probe:Drosophila_2:1630487_s_at:676:141; Interrogation_Position=185; Antisense; ACTGGACAAGGCTCTAAATCTGGAT
>probe:Drosophila_2:1630487_s_at:550:379; Interrogation_Position=20; Antisense; GAACCGGTTGAAATTCGTGCTCCGC
>probe:Drosophila_2:1630487_s_at:190:377; Interrogation_Position=251; Antisense; GAAGCAGTCGCCAATCATATTCACC
>probe:Drosophila_2:1630487_s_at:475:645; Interrogation_Position=265; Antisense; TCATATTCACCTGCCGGTCGGGAAA
>probe:Drosophila_2:1630487_s_at:323:519; Interrogation_Position=339; Antisense; GTGGTGATCTACAAAGGCTCCTGGA
>probe:Drosophila_2:1630487_s_at:706:71; Interrogation_Position=353; Antisense; AGGCTCCTGGAATGAATGGGCTCAA
>probe:Drosophila_2:1630487_s_at:158:455; Interrogation_Position=394; Antisense; GATAAACGTCGCTATATTTCTGAAT
>probe:Drosophila_2:1630487_s_at:229:217; Interrogation_Position=521; Antisense; AAGTTCTTGACTACACCCATGGCAA
>probe:Drosophila_2:1630487_s_at:700:159; Interrogation_Position=54; Antisense; ACAATGGCCACGTACGAACAGGTTA
>probe:Drosophila_2:1630487_s_at:221:483; Interrogation_Position=564; Antisense; GTATACACTCGCACTCAGAAAGCTG
>probe:Drosophila_2:1630487_s_at:195:63; Interrogation_Position=82; Antisense; ATGTGCCCAACCATCCGGATGTGTA
>probe:Drosophila_2:1630487_s_at:189:443; Interrogation_Position=99; Antisense; GATGTGTATCTTATCGACGTTCGAC

Paste this into a BLAST search page for me
AAGAGCTCCAGCAGACGGGCTTCATCTTCATTCCAGCCAGCATCAATATAACTGGACAAGGCTCTAAATCTGGATGAACCGGTTGAAATTCGTGCTCCGCGAAGCAGTCGCCAATCATATTCACCTCATATTCACCTGCCGGTCGGGAAAGTGGTGATCTACAAAGGCTCCTGGAAGGCTCCTGGAATGAATGGGCTCAAGATAAACGTCGCTATATTTCTGAATAAGTTCTTGACTACACCCATGGCAAACAATGGCCACGTACGAACAGGTTAGTATACACTCGCACTCAGAAAGCTGATGTGCCCAACCATCCGGATGTGTAGATGTGTATCTTATCGACGTTCGAC

Full Affymetrix probeset data:

Annotations for 1630487_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime