FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630488_at:

>probe:Drosophila_2:1630488_at:622:83; Interrogation_Position=166; Antisense; AGTGGCAGCAGCGTCCGCTTGGCCA
>probe:Drosophila_2:1630488_at:226:145; Interrogation_Position=19; Antisense; ACTGCGTCAGAATCCGCCAGGGCGG
>probe:Drosophila_2:1630488_at:218:87; Interrogation_Position=196; Antisense; AGTGCCCCGCGTAGAAGTGCCTGTG
>probe:Drosophila_2:1630488_at:441:219; Interrogation_Position=210; Antisense; AAGTGCCTGTGCCACATCGTATGTC
>probe:Drosophila_2:1630488_at:350:437; Interrogation_Position=253; Antisense; GAGGAGATTGTGTTCGCAGAGCCCA
>probe:Drosophila_2:1630488_at:493:101; Interrogation_Position=270; Antisense; AGAGCCCACGTATACCGAGCGATTT
>probe:Drosophila_2:1630488_at:310:121; Interrogation_Position=287; Antisense; AGCGATTTGCCCGATACTTTGTGAT
>probe:Drosophila_2:1630488_at:549:451; Interrogation_Position=309; Antisense; GATCGTGATCTATTTGTGCGGGCTC
>probe:Drosophila_2:1630488_at:224:525; Interrogation_Position=328; Antisense; GGGCTCTGCAGCCTGGGATTCTTTC
>probe:Drosophila_2:1630488_at:336:591; Interrogation_Position=341; Antisense; TGGGATTCTTTCTGTCCATCTACCA
>probe:Drosophila_2:1630488_at:72:39; Interrogation_Position=358; Antisense; ATCTACCACATCTTCTTCTGGGATT
>probe:Drosophila_2:1630488_at:193:49; Interrogation_Position=388; Antisense; ATGCCACCCGTTTACAAGGGCCAGA
>probe:Drosophila_2:1630488_at:326:313; Interrogation_Position=58; Antisense; GCCAGCATGGCGAATCTTGCCAAGA
>probe:Drosophila_2:1630488_at:122:465; Interrogation_Position=81; Antisense; GATTGTCAATCTCATCGAATCGAAC

Paste this into a BLAST search page for me
AGTGGCAGCAGCGTCCGCTTGGCCAACTGCGTCAGAATCCGCCAGGGCGGAGTGCCCCGCGTAGAAGTGCCTGTGAAGTGCCTGTGCCACATCGTATGTCGAGGAGATTGTGTTCGCAGAGCCCAAGAGCCCACGTATACCGAGCGATTTAGCGATTTGCCCGATACTTTGTGATGATCGTGATCTATTTGTGCGGGCTCGGGCTCTGCAGCCTGGGATTCTTTCTGGGATTCTTTCTGTCCATCTACCAATCTACCACATCTTCTTCTGGGATTATGCCACCCGTTTACAAGGGCCAGAGCCAGCATGGCGAATCTTGCCAAGAGATTGTCAATCTCATCGAATCGAAC

Full Affymetrix probeset data:

Annotations for 1630488_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720