FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630489_at:

>probe:Drosophila_2:1630489_at:623:135; Interrogation_Position=236; Antisense; ACGAAAATGGCCAGCTGAGATTCCT
>probe:Drosophila_2:1630489_at:559:427; Interrogation_Position=252; Antisense; GAGATTCCTGGCATCGGGCTTGAAC
>probe:Drosophila_2:1630489_at:48:117; Interrogation_Position=295; Antisense; AGCTCTTCAAACACCGGTATCAACT
>probe:Drosophila_2:1630489_at:593:193; Interrogation_Position=316; Antisense; AACTCGGCCCTGAATCAGTACATAA
>probe:Drosophila_2:1630489_at:305:717; Interrogation_Position=378; Antisense; TTCGGGCACCACATCAACGGGAACG
>probe:Drosophila_2:1630489_at:457:383; Interrogation_Position=398; Antisense; GAACGGGAGCTGTTACGGGCACATC
>probe:Drosophila_2:1630489_at:445:473; Interrogation_Position=409; Antisense; GTTACGGGCACATCGACGGGAACAA
>probe:Drosophila_2:1630489_at:348:563; Interrogation_Position=448; Antisense; GGAACCGGAACTGGCCTGGTCACCA
>probe:Drosophila_2:1630489_at:42:497; Interrogation_Position=466; Antisense; GTCACCACGACTTCCAATGGAGCTA
>probe:Drosophila_2:1630489_at:140:551; Interrogation_Position=484; Antisense; GGAGCTATCTATGTGAACCTGGGCA
>probe:Drosophila_2:1630489_at:15:203; Interrogation_Position=499; Antisense; AACCTGGGCAGTTCGGGATCCTCAT
>probe:Drosophila_2:1630489_at:583:79; Interrogation_Position=569; Antisense; AGGTCATCTATGGATCCTCGCCAGT
>probe:Drosophila_2:1630489_at:287:433; Interrogation_Position=638; Antisense; GAGTGCGTCCCGGTGGCCAGAACAA
>probe:Drosophila_2:1630489_at:67:101; Interrogation_Position=701; Antisense; AGAGGCGTGGCAGCATTAACAACAA

Paste this into a BLAST search page for me
ACGAAAATGGCCAGCTGAGATTCCTGAGATTCCTGGCATCGGGCTTGAACAGCTCTTCAAACACCGGTATCAACTAACTCGGCCCTGAATCAGTACATAATTCGGGCACCACATCAACGGGAACGGAACGGGAGCTGTTACGGGCACATCGTTACGGGCACATCGACGGGAACAAGGAACCGGAACTGGCCTGGTCACCAGTCACCACGACTTCCAATGGAGCTAGGAGCTATCTATGTGAACCTGGGCAAACCTGGGCAGTTCGGGATCCTCATAGGTCATCTATGGATCCTCGCCAGTGAGTGCGTCCCGGTGGCCAGAACAAAGAGGCGTGGCAGCATTAACAACAA

Full Affymetrix probeset data:

Annotations for 1630489_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720