Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630492_at:

>probe:Drosophila_2:1630492_at:707:249; Interrogation_Position=1288; Antisense; CAATCTCGTCGTGGGCGTGCTAACC
>probe:Drosophila_2:1630492_at:383:537; Interrogation_Position=1343; Antisense; GGTATCACGGCAGAGCAGATTGTCT
>probe:Drosophila_2:1630492_at:531:95; Interrogation_Position=1359; Antisense; AGATTGTCTCGTATCTGGAGCAGTA
>probe:Drosophila_2:1630492_at:201:421; Interrogation_Position=1376; Antisense; GAGCAGTATGCGCATCCCAATATGC
>probe:Drosophila_2:1630492_at:125:241; Interrogation_Position=1394; Antisense; AATATGCGCATGGTCGAGTCAGCCA
>probe:Drosophila_2:1630492_at:693:87; Interrogation_Position=1410; Antisense; AGTCAGCCATTCACTCTAAATCCTG
>probe:Drosophila_2:1630492_at:320:313; Interrogation_Position=1438; Antisense; GCCACCCACAGTCGTTGATCAAATT
>probe:Drosophila_2:1630492_at:205:395; Interrogation_Position=1482; Antisense; GAAATCGCTTCACCTACACCGAAGG
>probe:Drosophila_2:1630492_at:552:69; Interrogation_Position=1504; Antisense; AGGCGTGCTGTACAATCAGTTCCTC
>probe:Drosophila_2:1630492_at:660:469; Interrogation_Position=1522; Antisense; GTTCCTCTCGCATACAGATTTCGTA
>probe:Drosophila_2:1630492_at:629:491; Interrogation_Position=1544; Antisense; GTAACGCTACGAGACTACGCCCAGT
>probe:Drosophila_2:1630492_at:244:313; Interrogation_Position=1629; Antisense; GCCACGACGATGTCAAGCGTTACTG
>probe:Drosophila_2:1630492_at:23:599; Interrogation_Position=1675; Antisense; TGTTTAGCCCGGTATTACGACCAAT
>probe:Drosophila_2:1630492_at:261:373; Interrogation_Position=1718; Antisense; GAAGTAACATCTGTGCCCATTTTGT

Paste this into a BLAST search page for me
CAATCTCGTCGTGGGCGTGCTAACCGGTATCACGGCAGAGCAGATTGTCTAGATTGTCTCGTATCTGGAGCAGTAGAGCAGTATGCGCATCCCAATATGCAATATGCGCATGGTCGAGTCAGCCAAGTCAGCCATTCACTCTAAATCCTGGCCACCCACAGTCGTTGATCAAATTGAAATCGCTTCACCTACACCGAAGGAGGCGTGCTGTACAATCAGTTCCTCGTTCCTCTCGCATACAGATTTCGTAGTAACGCTACGAGACTACGCCCAGTGCCACGACGATGTCAAGCGTTACTGTGTTTAGCCCGGTATTACGACCAATGAAGTAACATCTGTGCCCATTTTGT

Full Affymetrix probeset data:

Annotations for 1630492_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime