Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630495_at:

>probe:Drosophila_2:1630495_at:126:125; Interrogation_Position=1006; Antisense; AGCCGCCCATGTGCGTGGTTTGGAA
>probe:Drosophila_2:1630495_at:358:481; Interrogation_Position=1023; Antisense; GTTTGGAACTATTACCGCATGAAGA
>probe:Drosophila_2:1630495_at:333:469; Interrogation_Position=1055; Antisense; GTTGCCTAGGTCTTCCTACAATTAC
>probe:Drosophila_2:1630495_at:396:691; Interrogation_Position=551; Antisense; TATTGACTCCCGTAAAAGATGCCTG
>probe:Drosophila_2:1630495_at:277:183; Interrogation_Position=564; Antisense; AAAAGATGCCTGTCCGATCGCTGTG
>probe:Drosophila_2:1630495_at:139:319; Interrogation_Position=602; Antisense; GCCGTCTGACCTCATGTTCTACAAG
>probe:Drosophila_2:1630495_at:262:715; Interrogation_Position=618; Antisense; TTCTACAAGCCCACCGATAAGCTGA
>probe:Drosophila_2:1630495_at:411:267; Interrogation_Position=681; Antisense; CAGGAGCGCAAAAGGAAGGCCGTTT
>probe:Drosophila_2:1630495_at:475:319; Interrogation_Position=719; Antisense; GCCCAAAATTCATCGACGGAGCCTT
>probe:Drosophila_2:1630495_at:506:47; Interrogation_Position=760; Antisense; ATCCTTCGAAGGTTTGCTCCAAAGG
>probe:Drosophila_2:1630495_at:340:695; Interrogation_Position=808; Antisense; TTTGCCGCCCGAAGCCAGCGAAGAG
>probe:Drosophila_2:1630495_at:631:615; Interrogation_Position=861; Antisense; TGCAAGCAGGCCATTACGACCGGCT
>probe:Drosophila_2:1630495_at:446:115; Interrogation_Position=939; Antisense; AGCTTTTCGGAGTGCCAACCGTATC
>probe:Drosophila_2:1630495_at:297:411; Interrogation_Position=983; Antisense; GACGCATTGCTTCTGCATCAACCAG

Paste this into a BLAST search page for me
AGCCGCCCATGTGCGTGGTTTGGAAGTTTGGAACTATTACCGCATGAAGAGTTGCCTAGGTCTTCCTACAATTACTATTGACTCCCGTAAAAGATGCCTGAAAAGATGCCTGTCCGATCGCTGTGGCCGTCTGACCTCATGTTCTACAAGTTCTACAAGCCCACCGATAAGCTGACAGGAGCGCAAAAGGAAGGCCGTTTGCCCAAAATTCATCGACGGAGCCTTATCCTTCGAAGGTTTGCTCCAAAGGTTTGCCGCCCGAAGCCAGCGAAGAGTGCAAGCAGGCCATTACGACCGGCTAGCTTTTCGGAGTGCCAACCGTATCGACGCATTGCTTCTGCATCAACCAG

Full Affymetrix probeset data:

Annotations for 1630495_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime